EMAIL THIS PAGE TO A FRIEND

SCGB2A1

secretoglobin, family 2A, member 1

35 Gene Product Result for
Synonyms: LPHC LPNC MGB2 UGB3
UniProtKB ID: O75556
Gene ID:
Rat(25010) secretoglobin, family 2A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002407 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057941 MISSION® esiRNA esiRNA human SCGB2A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002407 Rosetta Predictions human pricing
NM_080770 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154121 predicted 247
2 SASI_Hs01_00154122 predicted 256
3 SASI_Hs01_00154123 predicted 260
4 SASI_Hs01_00154124 predicted 247
5 SASI_Hs01_00154125 predicted 265
6 SASI_Hs01_00154126 predicted 290
7 SASI_Hs01_00154127 predicted 263
8 SASI_Hs01_00154128 predicted 293
9 SASI_Hs01_00154130 predicted 251
10 SASI_Hs02_00333781 predicted 289
11 SASI_Hs01_00154129 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054561 predicted 259
2 SASI_Rn01_00054562 predicted 217
3 SASI_Rn01_00054563 predicted 257
4 SASI_Rn02_00267294 predicted 281
5 SASI_Rn01_00054564 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002407
SCGB2A1 MISSION shRNA Bacterial Glycerol Stock
secretoglobin, family 2A, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-299s1c1
Sequence:CCGGCTGATGATGCATACAGTGTACCTCGAGGTACACTGTATGCATCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-194s1c1
Sequence:CCGGGAGCTTCTTCAAGAGTTCATACTCGAGTATGAACTCTTGAAGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-319s1c1
Sequence:CCGGCGACAGCATTTGGTGTAATATCTCGAGATATTACACCAAATGCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-244s1c1
Sequence:CCGGGAAATTCAAGCAGTGTTTCCTCTCGAGAGGAAACACTGCTTGAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-203s1c1
Sequence:CCGGCAAGAGTTCATAGACAGTGATCTCGAGATCACTGTCTATGAACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-156s21c1
Sequence:CCGGAGACCATCAATTCCGACATATCTCGAGATATGTCGGAATTGATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-350s21c1
Sequence:CCGGTAACTTTACCCAAGGCGTTTGCTCGAGCAAACGCCTTGGGTAAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-105s21c1
Sequence:CCGGTGCACTGCTATGCAGATTCTGCTCGAGCAGAATCTGCATAGCAGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002407
SCGB2A1 MISSION shRNA shRNA Plasmid DNA
secretoglobin, family 2A, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-299s1c1
Sequence:CCGGCTGATGATGCATACAGTGTACCTCGAGGTACACTGTATGCATCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-194s1c1
Sequence:CCGGGAGCTTCTTCAAGAGTTCATACTCGAGTATGAACTCTTGAAGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-319s1c1
Sequence:CCGGCGACAGCATTTGGTGTAATATCTCGAGATATTACACCAAATGCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-244s1c1
Sequence:CCGGGAAATTCAAGCAGTGTTTCCTCTCGAGAGGAAACACTGCTTGAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-203s1c1
Sequence:CCGGCAAGAGTTCATAGACAGTGATCTCGAGATCACTGTCTATGAACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-156s21c1
Sequence:CCGGAGACCATCAATTCCGACATATCTCGAGATATGTCGGAATTGATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-350s21c1
Sequence:CCGGTAACTTTACCCAAGGCGTTTGCTCGAGCAAACGCCTTGGGTAAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-105s21c1
Sequence:CCGGTGCACTGCTATGCAGATTCTGCTCGAGCAGAATCTGCATAGCAGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002407
SCGB2A1 MISSION shRNA Lentiviral Transduction Particles
secretoglobin, family 2A, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-299s1c1
Sequence:CCGGCTGATGATGCATACAGTGTACCTCGAGGTACACTGTATGCATCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-194s1c1
Sequence:CCGGGAGCTTCTTCAAGAGTTCATACTCGAGTATGAACTCTTGAAGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-319s1c1
Sequence:CCGGCGACAGCATTTGGTGTAATATCTCGAGATATTACACCAAATGCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-244s1c1
Sequence:CCGGGAAATTCAAGCAGTGTTTCCTCTCGAGAGGAAACACTGCTTGAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002407.1-203s1c1
Sequence:CCGGCAAGAGTTCATAGACAGTGATCTCGAGATCACTGTCTATGAACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-156s21c1
Sequence:CCGGAGACCATCAATTCCGACATATCTCGAGATATGTCGGAATTGATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-350s21c1
Sequence:CCGGTAACTTTACCCAAGGCGTTTGCTCGAGCAAACGCCTTGGGTAAAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002407.2-105s21c1
Sequence:CCGGTGCACTGCTATGCAGATTCTGCTCGAGCAGAATCTGCATAGCAGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)