EMAIL THIS PAGE TO A FRIEND

SCLT1

sodium channel and clathrin linker 1

185 Gene Product Result for
Synonyms: CAP-1A CAP1A hCAP-1A
UniProtKB ID: Q96NL6, A4QN04, Q0VAH2, Q6P2M4
Gene ID:
Human(132320) Summary: SCLT1 acts as a linker protein between the voltage-gated sodium channel Na(v)1.8 (SCN10A; MIM 604427) and clathrin (see CLTC, MIM 118955) (Liu et al., 2005 [PubMed 15797711]
Mouse(67161) sodium channel and clathrin linker 1
Rat(266809) sodium channel and clathrin linker 1
Zebrafish(561057) sodium channel and clathrin linker 1
domestic cat(101084026) sodium channel and clathrin linker 1
Horse(100071834) sodium channel and clathrin linker 1
dog(483829) sodium channel and clathrin linker 1
chicken(422486) sodium channel and clathrin linker 1
domestic guinea pig(100725871) sodium channel and clathrin linker 1
naked mole-rat(101724109) sodium channel and clathrin linker 1
cow(534830) sodium channel and clathrin linker 1
sheep(101108690) sodium channel and clathrin linker 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144643 Rosetta Predictions human pricing
NM_153740 Rosetta Predictions rat pricing
NM_001081411 Rosetta Predictions mouse pricing
XM_982400 Rosetta Predictions mouse pricing
XM_982429 Rosetta Predictions mouse pricing
XM_982466 Rosetta Predictions mouse pricing
XM_982506 Rosetta Predictions mouse pricing
XM_982541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364495 predicted 2608
2 SASI_Hs01_00223253 predicted 1243
3 SASI_Hs01_00223254 predicted 1515
4 SASI_Hs02_00364496 predicted 2662
5 SASI_Hs02_00364497 predicted 2640
6 SASI_Hs01_00223256 predicted 1330
7 SASI_Hs01_00223257 predicted 2340
8 SASI_Hs01_00223258 predicted 1452
9 SASI_Hs01_00223259 predicted 1442
10 SASI_Hs01_00223261 predicted 2587
11 SASI_Hs01_00223255 predicted 1455
12 SASI_Hs01_00223260 predicted 1145
13 SASI_Hs01_00223262 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083311 predicted 691
2 SASI_Rn01_00083312 predicted 482
3 SASI_Rn01_00083313 predicted 353
4 SASI_Rn01_00083314 predicted 575
5 SASI_Rn01_00083315 predicted 462
6 SASI_Rn01_00083316 predicted 1837
7 SASI_Rn01_00083317 predicted 704
8 SASI_Rn01_00083318 predicted 1346
9 SASI_Rn02_00269038 predicted 778
10 SASI_Rn02_00269039 predicted 407
11 SASI_Rn01_00083319 predicted 662
12 SASI_Rn01_00083320 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298121 predicted 1724
2 SASI_Mm02_00298122 predicted 1453
3 SASI_Mm02_00298123 predicted 843
4 SASI_Mm02_00298124 predicted 1772
5 SASI_Mm02_00298125 predicted 2323
6 SASI_Mm02_00298126 predicted 1345
7 SASI_Mm02_00298127 predicted 1184
8 SASI_Mm02_00298128 predicted 624
9 SASI_Mm02_00298129 predicted 1793
10 SASI_Mm02_00298130 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231090 predicted 1315
2 SASI_Mm01_00231091 predicted 992
3 SASI_Mm01_00231092 predicted 1186
4 SASI_Mm01_00231093 predicted 947
5 SASI_Mm01_00231094 predicted 943
6 SASI_Mm01_00231095 predicted 1270
7 SASI_Mm01_00231096 predicted 1077
8 SASI_Mm01_00231097 predicted 1191
9 SASI_Mm01_00231098 predicted 989
10 SASI_Mm01_00231099 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250545 predicted 1310
2 SASI_Mm01_00250546 predicted 997
3 SASI_Mm01_00250547 predicted 1188
4 SASI_Mm01_00250548 predicted 945
5 SASI_Mm01_00250549 predicted 939
6 SASI_Mm01_00250550 predicted 1264
7 SASI_Mm01_00250551 predicted 1087
8 SASI_Mm01_00250552 predicted 1193
9 SASI_Mm01_00250553 predicted 993
10 SASI_Mm01_00250554 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246568 predicted 837
2 SASI_Mm01_00246569 predicted 1106
3 SASI_Mm01_00246570 predicted 728
4 SASI_Mm01_00246571 predicted 987
5 SASI_Mm01_00246572 predicted 1173
6 SASI_Mm01_00246573 predicted 767
7 SASI_Mm01_00246574 predicted 995
8 SASI_Mm01_00246575 predicted 1139
9 SASI_Mm01_00246576 predicted 966
10 SASI_Mm01_00246577 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254285 predicted 732
2 SASI_Mm01_00254286 predicted 523
3 SASI_Mm01_00254287 predicted 789
4 SASI_Mm01_00254288 predicted 1333
5 SASI_Mm01_00254289 predicted 590
6 SASI_Mm01_00254290 predicted 813
7 SASI_Mm01_00254291 predicted 1612
8 SASI_Mm01_00254292 predicted 1413
9 SASI_Mm01_00254293 predicted 769
10 SASI_Mm01_00254294 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222108 predicted 1309
2 SASI_Mm01_00222109 predicted 996
3 SASI_Mm01_00222110 predicted 1188
4 SASI_Mm01_00222111 predicted 942
5 SASI_Mm01_00222112 predicted 942
6 SASI_Mm01_00222113 predicted 1264
7 SASI_Mm01_00222114 predicted 1085
8 SASI_Mm01_00222115 predicted 1190
9 SASI_Mm01_00222116 predicted 983
10 SASI_Mm01_00222117 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144643
SCLT1 MISSION shRNA Bacterial Glycerol Stock
sodium channel and clathrin linker 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144643.1-1699s1c1
Sequence:CCGGGAAGAACTTTCAGCCCTTCAACTCGAGTTGAAGGGCTGAAAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2592s1c1
Sequence:CCGGCAGAACTTTAGAGTTGGGAAACTCGAGTTTCCCAACTCTAAAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-2163s21c1
Sequence:CCGGTCAATAAAGGAACGTGGATTTCTCGAGAAATCCACGTTCCTTTATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1340s21c1
Sequence:CCGGGCAGTTACAGTCTAGTATAAACTCGAGTTTATACTAGACTGTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144643.1-1396s1c1
Sequence:CCGGGCCAACCAATTAAGAACCGAACTCGAGTTCGGTTCTTAATTGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2613s1c1
Sequence:CCGGGCAGTTGGACTAGAAGTGTATCTCGAGATACACTTCTAGTCCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2586s1c1
Sequence:CCGGCACTCACAGAACTTTAGAGTTCTCGAGAACTCTAAAGTTCTGTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1317s21c1
Sequence:CCGGGAAGCATCAGATAGGCGTTTACTCGAGTAAACGCCTATCTGATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1009s21c1
Sequence:CCGGATATGACTGAGGCCCAGATTCCTCGAGGAATCTGGGCCTCAGTCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-858s21c1
Sequence:CCGGGAGGTAGGAACTGACATATATCTCGAGATATATGTCAGTTCCTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1619s21c1
Sequence:CCGGTGTACAAGATGCTACCATAAGCTCGAGCTTATGGTAGCATCTTGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144643.2-2733s21c1
Sequence:CCGGTGACCACTTCCTGTAAGTAAACTCGAGTTTACTTACAGGAAGTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1744s21c1
Sequence:CCGGGCCAAATTGAACGAGTCATTACTCGAGTAATGACTCGTTCAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-2453s21c1
Sequence:CCGGCAGACTTCAAAGGCGTCTAAGCTCGAGCTTAGACGCCTTTGAAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144643
SCLT1 MISSION shRNA shRNA Plasmid DNA
sodium channel and clathrin linker 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144643.1-1699s1c1
Sequence:CCGGGAAGAACTTTCAGCCCTTCAACTCGAGTTGAAGGGCTGAAAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2592s1c1
Sequence:CCGGCAGAACTTTAGAGTTGGGAAACTCGAGTTTCCCAACTCTAAAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-2163s21c1
Sequence:CCGGTCAATAAAGGAACGTGGATTTCTCGAGAAATCCACGTTCCTTTATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1340s21c1
Sequence:CCGGGCAGTTACAGTCTAGTATAAACTCGAGTTTATACTAGACTGTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144643.1-1396s1c1
Sequence:CCGGGCCAACCAATTAAGAACCGAACTCGAGTTCGGTTCTTAATTGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2613s1c1
Sequence:CCGGGCAGTTGGACTAGAAGTGTATCTCGAGATACACTTCTAGTCCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2586s1c1
Sequence:CCGGCACTCACAGAACTTTAGAGTTCTCGAGAACTCTAAAGTTCTGTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1317s21c1
Sequence:CCGGGAAGCATCAGATAGGCGTTTACTCGAGTAAACGCCTATCTGATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1009s21c1
Sequence:CCGGATATGACTGAGGCCCAGATTCCTCGAGGAATCTGGGCCTCAGTCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-858s21c1
Sequence:CCGGGAGGTAGGAACTGACATATATCTCGAGATATATGTCAGTTCCTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1619s21c1
Sequence:CCGGTGTACAAGATGCTACCATAAGCTCGAGCTTATGGTAGCATCTTGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144643.2-2733s21c1
Sequence:CCGGTGACCACTTCCTGTAAGTAAACTCGAGTTTACTTACAGGAAGTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1744s21c1
Sequence:CCGGGCCAAATTGAACGAGTCATTACTCGAGTAATGACTCGTTCAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-2453s21c1
Sequence:CCGGCAGACTTCAAAGGCGTCTAAGCTCGAGCTTAGACGCCTTTGAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144643
SCLT1 MISSION shRNA Lentiviral Transduction Particles
sodium channel and clathrin linker 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144643.1-1699s1c1
Sequence:CCGGGAAGAACTTTCAGCCCTTCAACTCGAGTTGAAGGGCTGAAAGTTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000134808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2592s1c1
Sequence:CCGGCAGAACTTTAGAGTTGGGAAACTCGAGTTTCCCAACTCTAAAGTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-2163s21c1
Sequence:CCGGTCAATAAAGGAACGTGGATTTCTCGAGAAATCCACGTTCCTTTATTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1340s21c1
Sequence:CCGGGCAGTTACAGTCTAGTATAAACTCGAGTTTATACTAGACTGTAACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000137249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144643.1-1396s1c1
Sequence:CCGGGCCAACCAATTAAGAACCGAACTCGAGTTCGGTTCTTAATTGGTTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000137221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2613s1c1
Sequence:CCGGGCAGTTGGACTAGAAGTGTATCTCGAGATACACTTCTAGTCCAACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000134982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144643.1-2586s1c1
Sequence:CCGGCACTCACAGAACTTTAGAGTTCTCGAGAACTCTAAAGTTCTGTGAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1317s21c1
Sequence:CCGGGAAGCATCAGATAGGCGTTTACTCGAGTAAACGCCTATCTGATGCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1009s21c1
Sequence:CCGGATATGACTGAGGCCCAGATTCCTCGAGGAATCTGGGCCTCAGTCATATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-858s21c1
Sequence:CCGGGAGGTAGGAACTGACATATATCTCGAGATATATGTCAGTTCCTACCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1619s21c1
Sequence:CCGGTGTACAAGATGCTACCATAAGCTCGAGCTTATGGTAGCATCTTGTACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144643.2-2733s21c1
Sequence:CCGGTGACCACTTCCTGTAAGTAAACTCGAGTTTACTTACAGGAAGTGGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-1744s21c1
Sequence:CCGGGCCAAATTGAACGAGTCATTACTCGAGTAATGACTCGTTCAATTTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144643.2-2453s21c1
Sequence:CCGGCAGACTTCAAAGGCGTCTAAGCTCGAGCTTAGACGCCTTTGAAGTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026008
SCLT1 MISSION shRNA Bacterial Glycerol Stock
sodium channel and clathrin linker 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-622s1c1
Sequence:CCGGCCTCCTCTCATTGCTGAGTATCTCGAGATACTCAGCAATGAGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-1285s1c1
Sequence:CCGGCAGCAGTTACAATCTAGTATACTCGAGTATACTAGATTGTAACTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-513s1c1
Sequence:CCGGGCAGCATCAAATCGAACATATCTCGAGATATGTTCGATTTGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026008.1-1595s1c1
Sequence:CCGGGCAGCTATCAAAGCAAGGAAACTCGAGTTTCCTTGCTTTGATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-1144s1c1
Sequence:CCGGGCCAGATTAGATCTGAGAGTTCTCGAGAACTCTCAGATCTAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026008
SCLT1 MISSION shRNA shRNA Plasmid DNA
sodium channel and clathrin linker 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-622s1c1
Sequence:CCGGCCTCCTCTCATTGCTGAGTATCTCGAGATACTCAGCAATGAGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-1285s1c1
Sequence:CCGGCAGCAGTTACAATCTAGTATACTCGAGTATACTAGATTGTAACTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-513s1c1
Sequence:CCGGGCAGCATCAAATCGAACATATCTCGAGATATGTTCGATTTGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026008.1-1595s1c1
Sequence:CCGGGCAGCTATCAAAGCAAGGAAACTCGAGTTTCCTTGCTTTGATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-1144s1c1
Sequence:CCGGGCCAGATTAGATCTGAGAGTTCTCGAGAACTCTCAGATCTAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026008
SCLT1 MISSION shRNA Lentiviral Transduction Particles
sodium channel and clathrin linker 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-622s1c1
Sequence:CCGGCCTCCTCTCATTGCTGAGTATCTCGAGATACTCAGCAATGAGAGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-1285s1c1
Sequence:CCGGCAGCAGTTACAATCTAGTATACTCGAGTATACTAGATTGTAACTGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-513s1c1
Sequence:CCGGGCAGCATCAAATCGAACATATCTCGAGATATGTTCGATTTGATGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026008.1-1595s1c1
Sequence:CCGGGCAGCTATCAAAGCAAGGAAACTCGAGTTTCCTTGCTTTGATAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026008.1-1144s1c1
Sequence:CCGGGCCAGATTAGATCTGAGAGTTCTCGAGAACTCTCAGATCTAATCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081411
SCLT1 MISSION shRNA Bacterial Glycerol Stock
sodium channel and clathrin linker 1
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000454022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081411.1-1724s21c1
Sequence:CCGGGTCAAATTGATCGAGCCATTACTCGAGTAATGGCTCGATCAATTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081411.1-2594s21c1
Sequence:CCGGAGCTGTTGTACCAAACGTATTCTCGAGAATACGTTTGGTACAACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081411
SCLT1 MISSION shRNA shRNA Plasmid DNA
sodium channel and clathrin linker 1
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000454022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081411.1-1724s21c1
Sequence:CCGGGTCAAATTGATCGAGCCATTACTCGAGTAATGGCTCGATCAATTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081411.1-2594s21c1
Sequence:CCGGAGCTGTTGTACCAAACGTATTCTCGAGAATACGTTTGGTACAACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081411
SCLT1 MISSION shRNA Lentiviral Transduction Particles
sodium channel and clathrin linker 1
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000454022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081411.1-1724s21c1
Sequence:CCGGGTCAAATTGATCGAGCCATTACTCGAGTAATGGCTCGATCAATTTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000440715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081411.1-2594s21c1
Sequence:CCGGAGCTGTTGTACCAAACGTATTCTCGAGAATACGTTTGGTACAACAGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???