EMAIL THIS PAGE TO A FRIEND

SCMH1

sex comb on midleg homolog 1 (Drosophila)

66 Gene Product Result for
Synonyms: Scml3
Gene ID:
Mouse(29871) sex comb on midleg homolog 1
Rat(362581) sex comb on midleg homolog 1 (Drosophila)
Zebrafish(100037329) sex comb on midleg homolog 1 (Drosophila)
chicken(768916) sex comb on midleg homolog 1 (Drosophila)
dog(482448) sex comb on midleg homolog 1 (Drosophila)
Horse(100067888) sex comb on midleg homolog 1 (Drosophila)
domestic cat(101100316) sex comb on midleg homolog 1 (Drosophila)
domestic guinea pig(100716583) sex comb on midleg homolog 1 (Drosophila)
Domestic Rabbit(100358694) sex comb on midleg homolog 1 (Drosophila)
naked mole-rat(101715938) sex comb on midleg homolog 1 (Drosophila)
cow(540926) sex comb on midleg homolog 1 (Drosophila)
sheep(101103519) sex comb on midleg homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012236 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031694 Rosetta Predictions human pricing
NM_012236 Rosetta Predictions human pricing
NM_001109669 Rosetta Predictions rat pricing
NM_013883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120653 predicted 1568
2 SASI_Hs01_00120654 predicted 1680
3 SASI_Hs01_00120655 predicted 1017
4 SASI_Hs01_00120656 predicted 1550
5 SASI_Hs01_00120657 predicted 1017
6 SASI_Hs01_00120658 predicted 1165
7 SASI_Hs01_00120659 predicted 1202
8 SASI_Hs01_00120660 predicted 1376
9 SASI_Hs02_00307706 predicted 1675
10 SASI_Hs01_00120661 predicted 1503
11 SASI_Hs01_00120652 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084985 predicted 1601
2 SASI_Hs01_00084986 predicted 1714
3 SASI_Hs01_00084987 predicted 1046
4 SASI_Hs01_00084988 predicted 1586
5 SASI_Hs01_00084989 predicted 1048
6 SASI_Hs01_00084990 predicted 1196
7 SASI_Hs01_00084991 predicted 1238
8 SASI_Hs01_00084992 predicted 1409
9 SASI_Hs02_00343925 predicted 1707
10 SASI_Hs01_00084993 predicted 1532
11 SASI_Hs01_00084984 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250552 predicted 446
2 SASI_Rn02_00250553 predicted 616
3 SASI_Rn02_00250554 predicted 1523
4 SASI_Rn02_00250555 predicted 560
5 SASI_Rn02_00250556 predicted 431
6 SASI_Rn02_00250557 predicted 980
7 SASI_Rn02_00250558 predicted 605
8 SASI_Rn02_00250559 predicted 445
9 SASI_Rn02_00250560 predicted 607
10 SASI_Rn02_00250561 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032154 predicted 1036
2 SASI_Mm01_00032155 predicted 483
3 SASI_Mm01_00032156 predicted 332
4 SASI_Mm02_00322909 predicted 1234
5 SASI_Mm01_00032157 predicted 670
6 SASI_Mm01_00032158 predicted 612
7 SASI_Mm01_00032159 predicted 1888
8 SASI_Mm01_00032160 predicted 1732
9 SASI_Mm01_00032161 predicted 1071
10 SASI_Mm01_00032162 predicted 663
11 SASI_Mm01_00032163 predicted 1986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013883
VALIDATED
SCMH1 MISSION shRNA Bacterial Glycerol Stock
sex comb on midleg homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-1734s1c1
Sequence:CCGGCCCTTTACACAGACTCACTTACTCGAGTAAGTGAGTCTGTGTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-2539s1c1
Sequence:CCGGGCCCTTCTATTTATTTCTCAACTCGAGTTGAGAAATAAATAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013883.1-714s1c1
Sequence:CCGGCCTCTAGGATTTCGGCTGAATCTCGAGATTCAGCCGAAATCCTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013883.1-1405s1c1
Sequence:CCGGCCACAGTTTGTATCTACTTGACTCGAGTCAAGTAGATACAAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-2237s1c1
Sequence:CCGGGCGCAGTGACATGATGATGAACTCGAGTTCATCATCATGTCACTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013883
VALIDATED
SCMH1 MISSION shRNA shRNA Plasmid DNA
sex comb on midleg homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-1734s1c1
Sequence:CCGGCCCTTTACACAGACTCACTTACTCGAGTAAGTGAGTCTGTGTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-2539s1c1
Sequence:CCGGGCCCTTCTATTTATTTCTCAACTCGAGTTGAGAAATAAATAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013883.1-714s1c1
Sequence:CCGGCCTCTAGGATTTCGGCTGAATCTCGAGATTCAGCCGAAATCCTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013883.1-1405s1c1
Sequence:CCGGCCACAGTTTGTATCTACTTGACTCGAGTCAAGTAGATACAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-2237s1c1
Sequence:CCGGGCGCAGTGACATGATGATGAACTCGAGTTCATCATCATGTCACTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013883
VALIDATED
SCMH1 MISSION shRNA Lentiviral Transduction Particles
sex comb on midleg homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-1734s1c1
Sequence:CCGGCCCTTTACACAGACTCACTTACTCGAGTAAGTGAGTCTGTGTAAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-2539s1c1
Sequence:CCGGGCCCTTCTATTTATTTCTCAACTCGAGTTGAGAAATAAATAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013883.1-714s1c1
Sequence:CCGGCCTCTAGGATTTCGGCTGAATCTCGAGATTCAGCCGAAATCCTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013883.1-1405s1c1
Sequence:CCGGCCACAGTTTGTATCTACTTGACTCGAGTCAAGTAGATACAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013883.1-2237s1c1
Sequence:CCGGGCGCAGTGACATGATGATGAACTCGAGTTCATCATCATGTCACTGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012236
VALIDATED
SCMH1 MISSION shRNA Bacterial Glycerol Stock
sex comb on midleg homolog 1 (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-553s1c1
Sequence:CCGGGAACACCACATCCACCTGTATCTCGAGATACAGGTGGATGTGGTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-1411s1c1
Sequence:CCGGCCCAACAGTTTGTATCTACTTCTCGAGAAGTAGATACAAACTGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_012236.1-2060s1c1
Sequence:CCGGGTCGAGGATGTGATGCAGTTTCTCGAGAAACTGCATCACATCCTCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-719s1c1
Sequence:CCGGCCTCTTGGATTTCGGCTGAATCTCGAGATTCAGCCGAAATCCAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-1541s1c1
Sequence:CCGGGCCTGTATCGACTGTGCTTATCTCGAGATAAGCACAGTCGATACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1756s21c1
Sequence:CCGGGTTTGGCAACCAGCCCTTTACCTCGAGGTAAAGGGCTGGTTGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1218s21c1
Sequence:CCGGGGACACCCAAGACCCTAATTTCTCGAGAAATTAGGGTCTTGGGTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1896s21c1
Sequence:CCGGCAATGGACTCTGCCTCAAATCCTCGAGGATTTGAGGCAGAGTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1734s21c1
Sequence:CCGGACAACCTTCGTAGTGACAATCCTCGAGGATTGTCACTACGAAGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-540s21c1
Sequence:CCGGAGTTCAAGATCAGTATGAAATCTCGAGATTTCATACTGATCTTGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012236.3-2762s21c1
Sequence:CCGGGGGCAAACCCTGTAGTTAATACTCGAGTATTAACTACAGGGTTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1635s21c1
Sequence:CCGGAGGTTATCTCAGCCGTGTTTGCTCGAGCAAACACGGCTGAGATAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012236
VALIDATED
SCMH1 MISSION shRNA shRNA Plasmid DNA
sex comb on midleg homolog 1 (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-553s1c1
Sequence:CCGGGAACACCACATCCACCTGTATCTCGAGATACAGGTGGATGTGGTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-1411s1c1
Sequence:CCGGCCCAACAGTTTGTATCTACTTCTCGAGAAGTAGATACAAACTGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_012236.1-2060s1c1
Sequence:CCGGGTCGAGGATGTGATGCAGTTTCTCGAGAAACTGCATCACATCCTCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-719s1c1
Sequence:CCGGCCTCTTGGATTTCGGCTGAATCTCGAGATTCAGCCGAAATCCAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-1541s1c1
Sequence:CCGGGCCTGTATCGACTGTGCTTATCTCGAGATAAGCACAGTCGATACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1756s21c1
Sequence:CCGGGTTTGGCAACCAGCCCTTTACCTCGAGGTAAAGGGCTGGTTGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1218s21c1
Sequence:CCGGGGACACCCAAGACCCTAATTTCTCGAGAAATTAGGGTCTTGGGTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1896s21c1
Sequence:CCGGCAATGGACTCTGCCTCAAATCCTCGAGGATTTGAGGCAGAGTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1734s21c1
Sequence:CCGGACAACCTTCGTAGTGACAATCCTCGAGGATTGTCACTACGAAGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-540s21c1
Sequence:CCGGAGTTCAAGATCAGTATGAAATCTCGAGATTTCATACTGATCTTGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012236.3-2762s21c1
Sequence:CCGGGGGCAAACCCTGTAGTTAATACTCGAGTATTAACTACAGGGTTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1635s21c1
Sequence:CCGGAGGTTATCTCAGCCGTGTTTGCTCGAGCAAACACGGCTGAGATAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012236
VALIDATED
SCMH1 MISSION shRNA Lentiviral Transduction Particles
sex comb on midleg homolog 1 (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-553s1c1
Sequence:CCGGGAACACCACATCCACCTGTATCTCGAGATACAGGTGGATGTGGTGTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-1411s1c1
Sequence:CCGGCCCAACAGTTTGTATCTACTTCTCGAGAAGTAGATACAAACTGTTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_012236.1-2060s1c1
Sequence:CCGGGTCGAGGATGTGATGCAGTTTCTCGAGAAACTGCATCACATCCTCGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-719s1c1
Sequence:CCGGCCTCTTGGATTTCGGCTGAATCTCGAGATTCAGCCGAAATCCAAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012236.1-1541s1c1
Sequence:CCGGGCCTGTATCGACTGTGCTTATCTCGAGATAAGCACAGTCGATACAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1756s21c1
Sequence:CCGGGTTTGGCAACCAGCCCTTTACCTCGAGGTAAAGGGCTGGTTGCCAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1218s21c1
Sequence:CCGGGGACACCCAAGACCCTAATTTCTCGAGAAATTAGGGTCTTGGGTGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1896s21c1
Sequence:CCGGCAATGGACTCTGCCTCAAATCCTCGAGGATTTGAGGCAGAGTCCATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1734s21c1
Sequence:CCGGACAACCTTCGTAGTGACAATCCTCGAGGATTGTCACTACGAAGGTTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-540s21c1
Sequence:CCGGAGTTCAAGATCAGTATGAAATCTCGAGATTTCATACTGATCTTGAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012236.3-2762s21c1
Sequence:CCGGGGGCAAACCCTGTAGTTAATACTCGAGTATTAACTACAGGGTTTGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012236.3-1635s21c1
Sequence:CCGGAGGTTATCTCAGCCGTGTTTGCTCGAGCAAACACGGCTGAGATAACCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)