EMAIL THIS PAGE TO A FRIEND

Scn2a1

38 Gene Product Result for
Gene ID:
Rat(24766) sodium channel, voltage-gated, type II, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S6561 Anti-Sodium Channel, Brain Type II (α Subunit) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200074 Monoclonal Anti-SCN2A1 antibody produced in mouse clone S69-3, 1 mg/mL, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172141 MISSION® esiRNA esiRNA targeting mouse Scn2a1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012647 Rosetta Predictions rat pricing
NM_001099298 Rosetta Predictions mouse pricing
XM_909341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030677 predicted 3989
2 SASI_Rn01_00030678 predicted 2410
3 SASI_Rn02_00259892 predicted 2022
4 SASI_Rn01_00030679 predicted 1952
5 SASI_Rn01_00030680 predicted 4169
6 SASI_Rn01_00030681 predicted 4882
7 SASI_Rn02_00259893 predicted 3188
8 SASI_Rn01_00030682 predicted 1143
9 SASI_Rn01_00030684 predicted 4351
10 SASI_Rn01_00030685 predicted 3804
11 SASI_Rn01_00030683 predicted 1124
12 SASI_Rn01_00030686 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301581 predicted 4011
2 SASI_Mm02_00301582 predicted 3444
3 SASI_Mm02_00301583 predicted 2259
4 SASI_Mm02_00301584 predicted 639
5 SASI_Mm02_00301585 predicted 462
6 SASI_Mm02_00301586 predicted 3590
7 SASI_Mm02_00301587 predicted 4369
8 SASI_Mm02_00301588 predicted 3030
9 SASI_Mm02_00301589 predicted 4217
10 SASI_Mm02_00301590 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243925 predicted 3197
2 SASI_Mm01_00243926 predicted 1362
3 SASI_Mm01_00243927 predicted 791
4 SASI_Mm01_00243928 predicted 944
5 SASI_Mm01_00243929 predicted 1722
6 SASI_Mm01_00243930 predicted 2233
7 SASI_Mm01_00243931 predicted 603
8 SASI_Mm01_00243932 predicted 376
9 SASI_Mm01_00243933 predicted 469
10 SASI_Mm01_00243934 predicted 1562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099298
Scn2a1 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-4797s21c1
Sequence:CCGGGCTTATCTCACTCCGTCATTACTCGAGTAATGACGGAGTGAGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-3958s21c1
Sequence:CCGGATCAAATCCCTCCGAACATTACTCGAGTAATGTTCGGAGGGATTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-5829s21c1
Sequence:CCGGTAAGAAGGTTTCGTCTATATACTCGAGTATATAGACGAAACCTTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-1173s21c1
Sequence:CCGGCTTGTCCTTATTTCGTCTTATCTCGAGATAAGACGAAATAAGGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099298.2-7614s21c1
Sequence:CCGGTTAGATCTGTTGAAGGTATATCTCGAGATATACCTTCAACAGATCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099298
Scn2a1 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-4797s21c1
Sequence:CCGGGCTTATCTCACTCCGTCATTACTCGAGTAATGACGGAGTGAGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-3958s21c1
Sequence:CCGGATCAAATCCCTCCGAACATTACTCGAGTAATGTTCGGAGGGATTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-5829s21c1
Sequence:CCGGTAAGAAGGTTTCGTCTATATACTCGAGTATATAGACGAAACCTTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-1173s21c1
Sequence:CCGGCTTGTCCTTATTTCGTCTTATCTCGAGATAAGACGAAATAAGGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099298.2-7614s21c1
Sequence:CCGGTTAGATCTGTTGAAGGTATATCTCGAGATATACCTTCAACAGATCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099298
Scn2a1 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-4797s21c1
Sequence:CCGGGCTTATCTCACTCCGTCATTACTCGAGTAATGACGGAGTGAGATAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-3958s21c1
Sequence:CCGGATCAAATCCCTCCGAACATTACTCGAGTAATGTTCGGAGGGATTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-5829s21c1
Sequence:CCGGTAAGAAGGTTTCGTCTATATACTCGAGTATATAGACGAAACCTTCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099298.2-1173s21c1
Sequence:CCGGCTTGTCCTTATTTCGTCTTATCTCGAGATAAGACGAAATAAGGACAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099298.2-7614s21c1
Sequence:CCGGTTAGATCTGTTGAAGGTATATCTCGAGATATACCTTCAACAGATCTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)