EMAIL THIS PAGE TO A FRIEND

SCN2A

sodium channel, voltage-gated, type II, alpha subunit

360 Gene Product Result for
Synonyms: BFIC3 BFIS3 BFNIS EIEE11 HBA HBSCI HBSCII NAC2 Na(v)1.2 Nav1.2 SCN2A1 SCN2A2
Gene ID:
Human(6326) Summary: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is heterogeneously expressed in the brain, and mutations in this gene have been linked to several seizure disorders. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
chicken(395945) sodium channel, voltage-gated, type II, alpha subunit
dog(478773) sodium channel, voltage-gated, type II, alpha subunit
Horse(100051816) sodium channel, voltage-gated, type II, alpha subunit
domestic cat(101080472) sodium channel, voltage-gated, type II, alpha subunit
domestic guinea pig(100716680) sodium channel, voltage-gated, type II, alpha subunit
naked mole-rat(101715020) sodium channel, voltage-gated, type II, alpha subunit
cow(539718) sodium channel, voltage-gated, type II, alpha subunit
sheep(101103126) sodium channel, voltage-gated, type II, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
MABN1586 Anti-SCN2A Antibody, clone 5H10.2 clone 5H10.2, from mouse human, human, human
western blot pricing
AB5206 Anti-Sodium Channel Antibody, Voltage Gated, Brain Type II clone, Chemicon®, from rabbit mouse, rat
immunohistochemistry, western blot pricing
S8809 Monoclonal Anti-Sodium Channel, Pan antibody produced in mouse ~1 mg/mL, clone K58/35, purified immunoglobulin mammals
immunofluorescence, immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M0814 R(−)-Me5 hydriodide solid human pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
UC177 (±)-Mephenytoin human pricing
SML1444 (±)-Mepivacaine hydrochloride ≥98% (HPLC) human pricing
PHL80964 (+)-Quinidine phyproof® Reference Substance human pricing
462047 1-(2,6-Dimethylphenoxy)-2-propanamine hydrochloride 97% human pricing
146668 2,4-Dichlorobenzyl alcohol 99% human pricing
Y0001620 2,4-Dichlorobenzyl alcohol European Pharmacopoeia (EP) Reference Standard human pricing
CDS021586 2-(Diethylamino)ethyl 4-amino-2-propoxybenzoate human pricing
D6658 5,5-Diphenylhydantoin solution drug standard, 1.0 mg/mL in methanol human pricing
1042918 Articaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML1093 Articaine hydrochloride ≥98% (HPLC) human pricing
Y0000079 Articaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1881 Articaine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B9050 Benoxinate hydrochloride meets USP testing specifications human pricing
1050009 Benoxinate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
B4386 Benoxinate hydrochloride ≥98% human pricing
94496 Carbamazepine analytical standard human pricing
PHR1067 Carbamazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1093001 Carbamazepine United States Pharmacopeia (USP) Reference Standard human pricing
C0450000 Carbamazepine European Pharmacopoeia (EP) Reference Standard human pricing
BP974 Carbamazepine British Pharmacopoeia (BP) Reference Standard human pricing
C-053 Carbamazepine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
D2920000 Disopyramide European Pharmacopoeia (EP) Reference Standard human pricing
D7275 Disopyramide human pricing
1222501 Disopyramide phosphate United States Pharmacopeia (USP) Reference Standard human pricing
D2922000 Disopyramide phosphate European Pharmacopoeia (EP) Reference Standard human pricing
D6035 Disopyramide phosphate salt human pricing
D9696 Dronedarone hydrochloride ≥98% (HPLC) human pricing
1228530 Dronedarone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0002121 Dronedarone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1230000 Dyclonine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1849 Dyclonine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
E9156 Encainide hydrochloride ≥98% (HPLC), powder human pricing
L-029 Lacosamide solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1392 Lamotrigine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1356756 Lamotrigine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001030 Lamotrigine European Pharmacopoeia (EP) Reference Standard human pricing
BP1097 Lamotrigine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001031 Lamotrigine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001085 Lamotrigine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-019 Lamotrigine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1034 Lidocaine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366002 Lidocaine United States Pharmacopeia (USP) Reference Standard human pricing
L0595000 Lidocaine European Pharmacopoeia (EP) Reference Standard human pricing
BP727 Lidocaine British Pharmacopoeia (BP) Reference Standard human pricing
PHR1257 Lidocaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366013 Lidocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0600000 Lidocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP214 Lidocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
L5647 Lidocaine hydrochloride monohydrate solid human pricing
L-018 Lidocaine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1385007 Mephenytoin United States Pharmacopeia (USP) Reference Standard human pricing
1387002 Mepivacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1955 Mepivacaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M0370000 Mepivacaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
M3189 Mepivacaine hydrochloride 98.0-102.0%, meets USP testing specifications human pricing
BP699 Mepivacaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
M2727 Mexiletine hydrochloride powder human pricing
1443250 Mexiletine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1860000 Mexiletine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001181 Orphenadrine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
75517 Orphenadrine hydrochloride ≥98.0% (AT) human pricing
Y0000100 Orphenadrine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1635 Oxcarbazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
19532 Oxcarbazepine analytical standard human pricing
1483152 Oxcarbazepine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001576 Oxcarbazepine European Pharmacopoeia (EP) Reference Standard human pricing
O-025 Oxcarbazepine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O0270000 Oxybuprocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP700 Oxybuprocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
34076 Phenazopyridine hydrochloride VETRANAL®, analytical standard human pricing
1515000 Phenazopyridine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1139 Phenytoin Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535008 Phenytoin United States Pharmacopeia (USP) Reference Standard human pricing
P1290000 Phenytoin European Pharmacopoeia (EP) Reference Standard human pricing
Y0001167 Phenytoin for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1492 Phenytoin sodium Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535507 Phenytoin sodium United States Pharmacopeia (USP) Reference Standard human pricing
P1300000 Phenytoin sodium European Pharmacopoeia (EP) Reference Standard human pricing
BP1238 Phenytoin sodium British Pharmacopoeia (BP) Reference Standard human pricing
P-063 Phenytoin solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001681 Prilocaine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P9547 Prilocaine hydrochloride ≥98% (TLC) human pricing
P3347 Prilocaine hydrochloride meets USP testing specifications human pricing
1561008 Prilocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P2939060 Prilocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP497 Prilocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1252 Procainamide hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1563502 Procainamide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML2088 Procainamide hydrochloride ≥98% (HPLC) human pricing
P3050000 Procainamide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P9391 Procainamide hydrochloride human pricing
81664 Procainamide hydrochloride purum, ≥98.0% (AT) human pricing
P9879 Procaine hydrochloride ≥97% human pricing
1564006 Procaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1161 Procaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
46608 Procaine hydrochloride VETRANAL®, analytical standard human pricing
P3100000 Procaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1571001 Proparacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P4554 Proparacaine hydrochloride analytical standard human pricing
1595000 Quinidine gluconate United States Pharmacopeia (USP) Reference Standard human pricing
Q5001 Quinidine gluconate salt analytical standard human pricing
Q0750 Quinidine hydrochloride monohydrate technical grade human pricing
1604337 Riluzole United States Pharmacopeia (USP) Reference Standard human pricing
R8404 Rufinamide ≥98% (HPLC), powder human pricing
PHR1625 Rufinamide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1606401 Rufinamide United States Pharmacopeia (USP) Reference Standard human pricing
T7383 Tetracaine ≥98% (TLC) human pricing
1649991 Tetracaine United States Pharmacopeia (USP) Reference Standard human pricing
T3812 Tetracaine meets USP testing specifications human pricing
Y0002117 Tetracaine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001002 Tetracaine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T7508 Tetracaine hydrochloride ≥99% human pricing
PHR1129 Tetracaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1650006 Tetracaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T0500000 Tetracaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T3937 Tetracaine hydrochloride meets USP testing specifications human pricing
T7645 Tetracaine hydrochloride Sigma Reference Standard human pricing
T0202 Tocainide hydrochloride ≥98% (HPLC), solid human pricing
1667552 Tocainide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Z2001 Zonisamide sodium salt ≥98% (HPLC), powder human pricing
Z-005 Zonisamide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D4007 5,5-Diphenylhydantoin ≥98% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
B5435 BIA 2-093 ≥98% (HPLC), solid human, rat pricing
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing
L7757 Lidocaine powder human, rat pricing
L1026 Lidocaine analytical standard human, rat pricing
O3764 Oxcarbazepine ≥98% (HPLC), solid human, rat pricing
R116 Riluzole solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021007 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040142 Rosetta Predictions human pricing
NM_001040143 Rosetta Predictions human pricing
NM_021007 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145543 predicted 4451
2 SASI_Hs01_00145544 predicted 2649
3 SASI_Hs01_00145546 predicted 1190
4 SASI_Hs01_00145547 predicted 4058
5 SASI_Hs01_00145548 predicted 3680
6 SASI_Hs01_00145549 predicted 2883
7 SASI_Hs01_00145550 predicted 4432
8 SASI_Hs01_00145551 predicted 4335
9 SASI_Hs01_00145552 predicted 1219
10 SASI_Hs02_00308852 predicted 3187
11 SASI_Hs01_00145545 predicted 2383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185408 predicted 4212
2 SASI_Hs01_00185409 predicted 2412
3 SASI_Hs01_00185411 predicted 952
4 SASI_Hs01_00185412 predicted 3814
5 SASI_Hs01_00185413 predicted 3445
6 SASI_Hs01_00185414 predicted 2643
7 SASI_Hs01_00185415 predicted 4189
8 SASI_Hs01_00185416 predicted 4097
9 SASI_Hs01_00185417 predicted 979
10 SASI_Hs02_00308853 predicted 2947
11 SASI_Hs01_00185410 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016984 predicted 4515
2 SASI_Hs01_00016985 predicted 2717
3 SASI_Hs01_00016987 predicted 1259
4 SASI_Hs01_00016988 predicted 4119
5 SASI_Hs01_00016989 predicted 3751
6 SASI_Hs01_00016990 predicted 2949
7 SASI_Hs01_00016991 predicted 4495
8 SASI_Hs01_00016992 predicted 4403
9 SASI_Hs01_00016993 predicted 1279
10 SASI_Hs02_00354477 predicted 3253
11 SASI_Hs01_00016986 predicted 2444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021007
SCN2A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type II, alpha subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-4267s1c1
Sequence:CCGGGCTCTCATTGAGAGCAATCAACTCGAGTTGATTGCTCTCAATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-3876s1c1
Sequence:CCGGGCTGCTAAAGTGGGTTGCATACTCGAGTATGCAACCCACTTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-1040s1c1
Sequence:CCGGGCATATTTAACTGGGATGAATCTCGAGATTCATCCCAGTTAAATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-3187s1c1
Sequence:CCGGGCCTTTGTTAGGAAGCAGAAACTCGAGTTTCTGCTTCCTAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-172s1c1
Sequence:CCGGGCTGCTATTGAACAACGCATTCTCGAGAATGCGTTGTTCAATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021007.2-6639s21c1
Sequence:CCGGAGACGATAGGAACCAATTTAACTCGAGTTAAATTGGTTCCTATCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021007.2-1132s21c1
Sequence:CCGGTAAGCGTGTTTGCGCTAATAGCTCGAGCTATTAGCGCAAACACGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021007
SCN2A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type II, alpha subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-4267s1c1
Sequence:CCGGGCTCTCATTGAGAGCAATCAACTCGAGTTGATTGCTCTCAATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-3876s1c1
Sequence:CCGGGCTGCTAAAGTGGGTTGCATACTCGAGTATGCAACCCACTTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-1040s1c1
Sequence:CCGGGCATATTTAACTGGGATGAATCTCGAGATTCATCCCAGTTAAATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-3187s1c1
Sequence:CCGGGCCTTTGTTAGGAAGCAGAAACTCGAGTTTCTGCTTCCTAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-172s1c1
Sequence:CCGGGCTGCTATTGAACAACGCATTCTCGAGAATGCGTTGTTCAATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021007.2-6639s21c1
Sequence:CCGGAGACGATAGGAACCAATTTAACTCGAGTTAAATTGGTTCCTATCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021007.2-1132s21c1
Sequence:CCGGTAAGCGTGTTTGCGCTAATAGCTCGAGCTATTAGCGCAAACACGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021007
SCN2A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type II, alpha subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-4267s1c1
Sequence:CCGGGCTCTCATTGAGAGCAATCAACTCGAGTTGATTGCTCTCAATGAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-3876s1c1
Sequence:CCGGGCTGCTAAAGTGGGTTGCATACTCGAGTATGCAACCCACTTTAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-1040s1c1
Sequence:CCGGGCATATTTAACTGGGATGAATCTCGAGATTCATCCCAGTTAAATATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-3187s1c1
Sequence:CCGGGCCTTTGTTAGGAAGCAGAAACTCGAGTTTCTGCTTCCTAACAAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021007.1-172s1c1
Sequence:CCGGGCTGCTATTGAACAACGCATTCTCGAGAATGCGTTGTTCAATAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021007.2-6639s21c1
Sequence:CCGGAGACGATAGGAACCAATTTAACTCGAGTTAAATTGGTTCCTATCGTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021007.2-1132s21c1
Sequence:CCGGTAAGCGTGTTTGCGCTAATAGCTCGAGCTATTAGCGCAAACACGCTTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???