EMAIL THIS PAGE TO A FRIEND

SCN2B

sodium channel, voltage-gated, type II, beta subunit

234 Gene Product Result for
Synonyms: ATFB14
UniProtKB ID: O60939, O75302, Q9UNN3
Gene ID:
Mouse(72821) sodium channel, voltage-gated, type II, beta
Rat(25349) sodium channel, voltage-gated, type II, beta
domestic guinea pig(100727231) sodium channel, voltage-gated, type II, beta subunit
naked mole-rat(101708585) sodium channel, voltage-gated, type II, beta subunit
cow(538722) sodium channel, voltage-gated, type II, beta
sheep(101121450) sodium channel, voltage-gated, type II, beta subunit
Zebrafish(777666) sodium channel, voltage-gated, type II, beta
dog(610797) sodium channel, voltage-gated, type II, beta subunit
dog(403485) sodium channel, voltage-gated, type II, beta subunit
domestic cat(101088270) sodium channel, voltage-gated, type II, beta subunit
chicken(419776) sodium channel, voltage-gated, type II, beta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012585 Anti-SCN2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
S6811 Anti-Sodium Channel (β2 Subunit) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
immunohistochemistry, western blot pricing
AB5358 Anti-Sodium Channel NaB2 Antibody clone, Chemicon®, from rabbit rat
immunohistochemistry, western blot pricing
SAB5202077 Monoclonal Anti-Nav beta2 -Atto 390 antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202076 Monoclonal Anti-Nav beta2 antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202085 Monoclonal Anti-Nav beta2-Alkaline Phosphatase antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202086 Monoclonal Anti-Nav beta2-Allophycocyanin antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202078 Monoclonal Anti-Nav beta2-Atto 488 antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202080 Monoclonal Anti-Nav beta2-Atto 594 antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202079 Monoclonal Anti-Nav beta2-Atto 595 antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202081 Monoclonal Anti-Nav beta2-Atto 633 antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202082 Monoclonal Anti-Nav beta2-Atto 655 antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202083 Monoclonal Anti-Nav beta2-Atto 680 antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202084 Monoclonal Anti-Nav beta2-Atto 700 antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202087 Monoclonal Anti-Nav beta2-Biotin antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202088 Monoclonal Anti-Nav beta2-FITC antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
SAB5202089 Monoclonal Anti-Nav beta2-Horseradish Peroxidase antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202090 Monoclonal Anti-Nav beta2-PE/Atto 594 antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202091 Monoclonal Anti-Nav beta2-PerCP antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202092 Monoclonal Anti-Nav beta2-R-Phycoerythrin antibody produced in mouse clone S395-68 human, rat
immunofluorescence, western blot pricing
SAB5202093 Monoclonal Anti-Nav beta2-Streptavidin antibody produced in mouse clone S395-68 rat, human
immunofluorescence, western blot pricing
WH0006327M1 Monoclonal Anti-SCN2B antibody produced in mouse clone 2G11-C12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004588 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004588 Rosetta Predictions human pricing
NM_012877 Rosetta Predictions rat pricing
NM_001014761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083790 predicted 358
2 SASI_Hs01_00083791 predicted 719
3 SASI_Hs01_00083792 predicted 348
4 SASI_Hs01_00083793 predicted 411
5 SASI_Hs02_00337950 predicted 914
6 SASI_Hs01_00083794 predicted 434
7 SASI_Hs01_00083795 predicted 763
8 SASI_Hs01_00083796 predicted 795
9 SASI_Hs01_00083797 predicted 1001
10 SASI_Hs01_00083798 predicted 375
11 SASI_Hs01_00083799 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260385 predicted 525
2 SASI_Rn01_00083016 predicted 383
3 SASI_Rn01_00083017 predicted 278
4 SASI_Rn01_00083018 predicted 368
5 SASI_Rn01_00083019 predicted 436
6 SASI_Rn01_00083020 predicted 370
7 SASI_Rn01_00083021 predicted 477
8 SASI_Rn01_00083022 predicted 510
9 SASI_Rn01_00083023 predicted 583
10 SASI_Rn01_00083024 predicted 428
11 SASI_Rn01_00083025 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287435 predicted 1129
2 SASI_Mm02_00287436 predicted 1144
3 SASI_Mm02_00287437 predicted 1102
4 SASI_Mm02_00287438 predicted 1207
5 SASI_Mm02_00287439 predicted 350
6 SASI_Mm02_00287440 predicted 250
7 SASI_Mm02_00287441 predicted 264
8 SASI_Mm02_00287442 predicted 315
9 SASI_Mm02_00287443 predicted 355
10 SASI_Mm02_00287444 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014761
SCN2B MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type II, beta subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014761.1-3419s1c1
Sequence:CCGGGCAGGTAGATAGGTGGAAATACTCGAGTATTTCCACCTATCTACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-511s1c1
Sequence:CCGGGCATTTACAACTGCTACATTACTCGAGTAATGTAGCAGTTGTAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-259s1c1
Sequence:CCGGGTGTCCTCAATGGGTCCGATACTCGAGTATCGGACCCATTGAGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-383s1c1
Sequence:CCGGCCTCCAGTTCCGAATGAAGATCTCGAGATCTTCATTCGGAACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-290s1c1
Sequence:CCGGCTGTACCTTCAACTCCTGCTACTCGAGTAGCAGGAGTTGAAGGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014761
SCN2B MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type II, beta subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014761.1-3419s1c1
Sequence:CCGGGCAGGTAGATAGGTGGAAATACTCGAGTATTTCCACCTATCTACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-511s1c1
Sequence:CCGGGCATTTACAACTGCTACATTACTCGAGTAATGTAGCAGTTGTAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-259s1c1
Sequence:CCGGGTGTCCTCAATGGGTCCGATACTCGAGTATCGGACCCATTGAGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-383s1c1
Sequence:CCGGCCTCCAGTTCCGAATGAAGATCTCGAGATCTTCATTCGGAACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-290s1c1
Sequence:CCGGCTGTACCTTCAACTCCTGCTACTCGAGTAGCAGGAGTTGAAGGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014761
SCN2B MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type II, beta subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014761.1-3419s1c1
Sequence:CCGGGCAGGTAGATAGGTGGAAATACTCGAGTATTTCCACCTATCTACCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-511s1c1
Sequence:CCGGGCATTTACAACTGCTACATTACTCGAGTAATGTAGCAGTTGTAAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-259s1c1
Sequence:CCGGGTGTCCTCAATGGGTCCGATACTCGAGTATCGGACCCATTGAGGACACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-383s1c1
Sequence:CCGGCCTCCAGTTCCGAATGAAGATCTCGAGATCTTCATTCGGAACTGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014761.1-290s1c1
Sequence:CCGGCTGTACCTTCAACTCCTGCTACTCGAGTAGCAGGAGTTGAAGGTACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004588
SCN2B MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type II, beta subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-290s1c1
Sequence:CCGGCCACAAACAGTTCTCCCTGAACTCGAGTTCAGGGAGAACTGTTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004588.2-1938s1c1
Sequence:CCGGCCTCCATCTGTTTAGTAGAAACTCGAGTTTCTACTAAACAGATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-482s1c1
Sequence:CCGGGATTTACAACTGCTACATCATCTCGAGATGATGTAGCAGTTGTAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-359s1c1
Sequence:CCGGGTTCCGCATGAAGATCATTAACTCGAGTTAATGATCTTCATGCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-740s1c1
Sequence:CCGGCCCGGATGATGGTGCCAAGTACTCGAGTACTTGGCACCATCATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004588
SCN2B MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type II, beta subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-290s1c1
Sequence:CCGGCCACAAACAGTTCTCCCTGAACTCGAGTTCAGGGAGAACTGTTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004588.2-1938s1c1
Sequence:CCGGCCTCCATCTGTTTAGTAGAAACTCGAGTTTCTACTAAACAGATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-482s1c1
Sequence:CCGGGATTTACAACTGCTACATCATCTCGAGATGATGTAGCAGTTGTAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-359s1c1
Sequence:CCGGGTTCCGCATGAAGATCATTAACTCGAGTTAATGATCTTCATGCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-740s1c1
Sequence:CCGGCCCGGATGATGGTGCCAAGTACTCGAGTACTTGGCACCATCATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004588
SCN2B MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type II, beta subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-290s1c1
Sequence:CCGGCCACAAACAGTTCTCCCTGAACTCGAGTTCAGGGAGAACTGTTTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004588.2-1938s1c1
Sequence:CCGGCCTCCATCTGTTTAGTAGAAACTCGAGTTTCTACTAAACAGATGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-482s1c1
Sequence:CCGGGATTTACAACTGCTACATCATCTCGAGATGATGTAGCAGTTGTAAATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-359s1c1
Sequence:CCGGGTTCCGCATGAAGATCATTAACTCGAGTTAATGATCTTCATGCGGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004588.2-740s1c1
Sequence:CCGGCCCGGATGATGGTGCCAAGTACTCGAGTACTTGGCACCATCATCCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???