EMAIL THIS PAGE TO A FRIEND

SCN4A

sodium channel, voltage-gated, type IV, alpha subunit

208 Gene Product Result for
Synonyms: HOKPP2 HYKPP HYPP NAC1A Na(V)1.4 Nav1.4 SkM1
UniProtKB ID: P35499, Q15478, Q16447, Q7Z6B1
Gene ID:
Human(6329) Summary: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
Mouse(110880) sodium channel, voltage-gated, type IV, alpha
Rat(25722) sodium channel, voltage-gated, type IV, alpha subunit
domestic guinea pig(100717730) sodium channel, voltage-gated, type IV, alpha subunit
naked mole-rat(101713228) sodium channel, voltage-gated, type IV, alpha subunit
cow(517426) sodium channel, voltage-gated, type IV, alpha subunit
sheep(101123056) sodium channel, voltage-gated, type IV, alpha subunit
chicken(771297) sodium channel, voltage-gated, type IV, alpha subunit
Horse(100049793) sodium channel, voltage-gated, type IV, alpha subunit
domestic cat(101098669) sodium channel, voltage-gated, type IV, alpha subunit
dog(610754) sodium channel, voltage-gated, type IV, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
UC177 (±)-Mephenytoin human pricing
SML1444 (±)-Mepivacaine hydrochloride ≥98% (HPLC) human pricing
PHL80964 (+)-Quinidine phyproof® Reference Substance human pricing
462047 1-(2,6-Dimethylphenoxy)-2-propanamine hydrochloride 97% human pricing
Y0001620 2,4-Dichlorobenzyl alcohol European Pharmacopoeia (EP) Reference Standard human pricing
146668 2,4-Dichlorobenzyl alcohol 99% human pricing
CDS021586 2-(Diethylamino)ethyl 4-amino-2-propoxybenzoate human pricing
D6658 5,5-Diphenylhydantoin solution drug standard, 1.0 mg/mL in methanol human pricing
Y0000079 Articaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
SML1093 Articaine hydrochloride ≥98% (HPLC) human pricing
1042918 Articaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1881 Articaine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B9050 Benoxinate hydrochloride meets USP testing specifications human pricing
1050009 Benoxinate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
B4386 Benoxinate hydrochloride ≥98% human pricing
94496 Carbamazepine analytical standard human pricing
PHR1067 Carbamazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1093001 Carbamazepine United States Pharmacopeia (USP) Reference Standard human pricing
BP974 Carbamazepine British Pharmacopoeia (BP) Reference Standard human pricing
C0450000 Carbamazepine European Pharmacopoeia (EP) Reference Standard human pricing
C-053 Carbamazepine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
D2920000 Disopyramide European Pharmacopoeia (EP) Reference Standard human pricing
D7275 Disopyramide human pricing
1222501 Disopyramide phosphate United States Pharmacopeia (USP) Reference Standard human pricing
D2922000 Disopyramide phosphate European Pharmacopoeia (EP) Reference Standard human pricing
D6035 Disopyramide phosphate salt human pricing
D9696 Dronedarone hydrochloride ≥98% (HPLC) human pricing
Y0002121 Dronedarone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1228530 Dronedarone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
1230000 Dyclonine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1849 Dyclonine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
E9156 Encainide hydrochloride ≥98% (HPLC), powder human pricing
L-029 Lacosamide solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1392 Lamotrigine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001030 Lamotrigine European Pharmacopoeia (EP) Reference Standard human pricing
BP1097 Lamotrigine British Pharmacopoeia (BP) Reference Standard human pricing
1356756 Lamotrigine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001031 Lamotrigine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001085 Lamotrigine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-019 Lamotrigine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
SML1092 Levobupivacaine hydrochloride ≥98% (HPLC) human pricing
PHR1034 Lidocaine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366002 Lidocaine United States Pharmacopeia (USP) Reference Standard human pricing
L0595000 Lidocaine European Pharmacopoeia (EP) Reference Standard human pricing
BP727 Lidocaine British Pharmacopoeia (BP) Reference Standard human pricing
PHR1257 Lidocaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366013 Lidocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0600000 Lidocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP214 Lidocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
L5647 Lidocaine hydrochloride monohydrate solid human pricing
L-018 Lidocaine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1385007 Mephenytoin United States Pharmacopeia (USP) Reference Standard human pricing
PHR1955 Mepivacaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M0370000 Mepivacaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1387002 Mepivacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP699 Mepivacaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
M3189 Mepivacaine hydrochloride 98.0-102.0%, meets USP testing specifications human pricing
M2727 Mexiletine hydrochloride powder human pricing
1443250 Mexiletine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1860000 Mexiletine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001181 Orphenadrine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
75517 Orphenadrine hydrochloride ≥98.0% (AT) human pricing
Y0000100 Orphenadrine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1635 Oxcarbazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001576 Oxcarbazepine European Pharmacopoeia (EP) Reference Standard human pricing
19532 Oxcarbazepine analytical standard human pricing
1483152 Oxcarbazepine United States Pharmacopeia (USP) Reference Standard human pricing
O-025 Oxcarbazepine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O0270000 Oxybuprocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP700 Oxybuprocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
34076 Phenazopyridine hydrochloride VETRANAL®, analytical standard human pricing
1515000 Phenazopyridine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1139 Phenytoin Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535008 Phenytoin United States Pharmacopeia (USP) Reference Standard human pricing
P1290000 Phenytoin European Pharmacopoeia (EP) Reference Standard human pricing
Y0001167 Phenytoin for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1535507 Phenytoin sodium United States Pharmacopeia (USP) Reference Standard human pricing
PHR1492 Phenytoin sodium Pharmaceutical Secondary Standard; Certified Reference Material human pricing
P1300000 Phenytoin sodium European Pharmacopoeia (EP) Reference Standard human pricing
BP1238 Phenytoin sodium British Pharmacopoeia (BP) Reference Standard human pricing
P-063 Phenytoin solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001681 Prilocaine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P9547 Prilocaine hydrochloride ≥98% (TLC) human pricing
P3347 Prilocaine hydrochloride meets USP testing specifications human pricing
1561008 Prilocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P2939060 Prilocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP497 Prilocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
SML2088 Procainamide hydrochloride ≥98% (HPLC) human pricing
PHR1252 Procainamide hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1563502 Procainamide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P3050000 Procainamide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
81664 Procainamide hydrochloride purum, ≥98.0% (AT) human pricing
P9391 Procainamide hydrochloride human pricing
P9879 Procaine hydrochloride ≥97% human pricing
PHR1161 Procaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1564006 Procaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
46608 Procaine hydrochloride VETRANAL®, analytical standard human pricing
P3100000 Procaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1571001 Proparacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P4554 Proparacaine hydrochloride analytical standard human pricing
1595000 Quinidine gluconate United States Pharmacopeia (USP) Reference Standard human pricing
Q5001 Quinidine gluconate salt analytical standard human pricing
Q0750 Quinidine hydrochloride monohydrate technical grade human pricing
R6152 Ranolazine dihydrochloride ≥98% (HPLC), powder human pricing
1604337 Riluzole United States Pharmacopeia (USP) Reference Standard human pricing
1606401 Rufinamide United States Pharmacopeia (USP) Reference Standard human pricing
PHR1625 Rufinamide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
R8404 Rufinamide ≥98% (HPLC), powder human pricing
T7383 Tetracaine ≥98% (TLC) human pricing
Y0002117 Tetracaine European Pharmacopoeia (EP) Reference Standard human pricing
1649991 Tetracaine United States Pharmacopeia (USP) Reference Standard human pricing
T3812 Tetracaine meets USP testing specifications human pricing
Y0001002 Tetracaine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T7508 Tetracaine hydrochloride ≥99% human pricing
PHR1129 Tetracaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1650006 Tetracaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T0500000 Tetracaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T3937 Tetracaine hydrochloride meets USP testing specifications human pricing
T7645 Tetracaine hydrochloride Sigma Reference Standard human pricing
1667552 Tocainide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T0202 Tocainide hydrochloride ≥98% (HPLC), solid human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Z2001 Zonisamide sodium salt ≥98% (HPLC), powder human pricing
Z-005 Zonisamide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D4007 5,5-Diphenylhydantoin ≥98% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
B5435 BIA 2-093 ≥98% (HPLC), solid human, rat pricing
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing
L7757 Lidocaine powder human, rat pricing
L1026 Lidocaine analytical standard human, rat pricing
O3764 Oxcarbazepine ≥98% (HPLC), solid human, rat pricing
R116 Riluzole solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000334 Rosetta Predictions human pricing
NM_013178 Rosetta Predictions rat pricing
NM_133199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226690 predicted 321
2 SASI_Hs01_00226691 predicted 3338
3 SASI_Hs01_00226692 predicted 3881
4 SASI_Hs02_00302351 predicted 2523
5 SASI_Hs01_00226693 predicted 493
6 SASI_Hs01_00226694 predicted 4813
7 SASI_Hs01_00226695 predicted 3609
8 SASI_Hs01_00226696 predicted 4579
9 SASI_Hs01_00226697 predicted 442
10 SASI_Hs01_00226698 predicted 257
11 SASI_Hs01_00226689 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108472 predicted 4208
2 SASI_Rn01_00108473 predicted 987
3 SASI_Rn01_00108474 predicted 4478
4 SASI_Rn01_00108475 predicted 4651
5 SASI_Rn01_00108476 predicted 2071
6 SASI_Rn01_00108477 predicted 5385
7 SASI_Rn01_00108478 predicted 1432
8 SASI_Rn01_00108479 predicted 3498
9 SASI_Rn01_00108480 predicted 5949
10 SASI_Rn01_00108481 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133184 predicted 541
2 SASI_Mm02_00338388 predicted 2141
3 SASI_Mm01_00133185 predicted 4040
4 SASI_Mm01_00133186 predicted 4200
5 SASI_Mm01_00133188 predicted 1686
6 SASI_Mm01_00133189 predicted 246
7 SASI_Mm02_00338389 predicted 4944
8 SASI_Mm01_00133191 predicted 3769
9 SASI_Mm01_00133192 predicted 1630
10 SASI_Mm02_00338390 predicted 1790
11 SASI_Mm01_00133183 predicted 4876
12 SASI_Mm01_00133187 predicted 3058
13 SASI_Mm01_00133190 predicted 982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133199
SCN4A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type IV, alpha subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133199.1-5662s1c1
Sequence:CCGGCGCCTCCTGATTTAATCTTTACTCGAGTAAAGATTAAATCAGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-4948s1c1
Sequence:CCGGGCCCAATAAGATCAAGCTTATCTCGAGATAAGCTTGATCTTATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-4204s1c1
Sequence:CCGGGCGCCATTACTACTTCACCATCTCGAGATGGTGAAGTAGTAATGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-2032s1c1
Sequence:CCGGGCCAACACTCAACATGCTCATCTCGAGATGAGCATGTTGAGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-122s1c1
Sequence:CCGGCGGAACAAGCAAATGGAGATTCTCGAGAATCTCCATTTGCTTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133199
SCN4A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type IV, alpha subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133199.1-5662s1c1
Sequence:CCGGCGCCTCCTGATTTAATCTTTACTCGAGTAAAGATTAAATCAGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-4948s1c1
Sequence:CCGGGCCCAATAAGATCAAGCTTATCTCGAGATAAGCTTGATCTTATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-4204s1c1
Sequence:CCGGGCGCCATTACTACTTCACCATCTCGAGATGGTGAAGTAGTAATGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-2032s1c1
Sequence:CCGGGCCAACACTCAACATGCTCATCTCGAGATGAGCATGTTGAGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-122s1c1
Sequence:CCGGCGGAACAAGCAAATGGAGATTCTCGAGAATCTCCATTTGCTTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133199
SCN4A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type IV, alpha subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133199.1-5662s1c1
Sequence:CCGGCGCCTCCTGATTTAATCTTTACTCGAGTAAAGATTAAATCAGGAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-4948s1c1
Sequence:CCGGGCCCAATAAGATCAAGCTTATCTCGAGATAAGCTTGATCTTATTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-4204s1c1
Sequence:CCGGGCGCCATTACTACTTCACCATCTCGAGATGGTGAAGTAGTAATGGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-2032s1c1
Sequence:CCGGGCCAACACTCAACATGCTCATCTCGAGATGAGCATGTTGAGTGTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133199.1-122s1c1
Sequence:CCGGCGGAACAAGCAAATGGAGATTCTCGAGAATCTCCATTTGCTTGTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000334
SCN4A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type IV, alpha subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-5396s1c1
Sequence:CCGGCAACACCATGAGCAAGATGTACTCGAGTACATCTTGCTCATGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-1069s1c1
Sequence:CCGGCCACCAACGATACCTTTGATTCTCGAGAATCAAAGGTATCGTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-3893s1c1
Sequence:CCGGCCTCTACTTTGTCATCTTCATCTCGAGATGAAGATGACAAAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-3281s1c1
Sequence:CCGGCGACAAGGTCTTCACCTACATCTCGAGATGTAGGTGAAGACCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-198s1c1
Sequence:CCGGCGGAATAAGCAGATGGAGATTCTCGAGAATCTCCATCTGCTTATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-497s21c1
Sequence:CCGGCATCTTGACCAACTGCGTATTCTCGAGAATACGCAGTTGGTCAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-1729s21c1
Sequence:CCGGGCGCCCACAAAGTGCTCATATCTCGAGATATGAGCACTTTGTGGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-685s21c1
Sequence:CCGGTGGCGTACCTGACAGAGTTTGCTCGAGCAAACTCTGTCAGGTACGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000334
SCN4A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type IV, alpha subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-5396s1c1
Sequence:CCGGCAACACCATGAGCAAGATGTACTCGAGTACATCTTGCTCATGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-1069s1c1
Sequence:CCGGCCACCAACGATACCTTTGATTCTCGAGAATCAAAGGTATCGTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-3893s1c1
Sequence:CCGGCCTCTACTTTGTCATCTTCATCTCGAGATGAAGATGACAAAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-3281s1c1
Sequence:CCGGCGACAAGGTCTTCACCTACATCTCGAGATGTAGGTGAAGACCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-198s1c1
Sequence:CCGGCGGAATAAGCAGATGGAGATTCTCGAGAATCTCCATCTGCTTATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-497s21c1
Sequence:CCGGCATCTTGACCAACTGCGTATTCTCGAGAATACGCAGTTGGTCAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-1729s21c1
Sequence:CCGGGCGCCCACAAAGTGCTCATATCTCGAGATATGAGCACTTTGTGGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-685s21c1
Sequence:CCGGTGGCGTACCTGACAGAGTTTGCTCGAGCAAACTCTGTCAGGTACGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000334
SCN4A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type IV, alpha subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-5396s1c1
Sequence:CCGGCAACACCATGAGCAAGATGTACTCGAGTACATCTTGCTCATGGTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-1069s1c1
Sequence:CCGGCCACCAACGATACCTTTGATTCTCGAGAATCAAAGGTATCGTTGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-3893s1c1
Sequence:CCGGCCTCTACTTTGTCATCTTCATCTCGAGATGAAGATGACAAAGTAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-3281s1c1
Sequence:CCGGCGACAAGGTCTTCACCTACATCTCGAGATGTAGGTGAAGACCTTGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000334.3-198s1c1
Sequence:CCGGCGGAATAAGCAGATGGAGATTCTCGAGAATCTCCATCTGCTTATTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-497s21c1
Sequence:CCGGCATCTTGACCAACTGCGTATTCTCGAGAATACGCAGTTGGTCAAGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-1729s21c1
Sequence:CCGGGCGCCCACAAAGTGCTCATATCTCGAGATATGAGCACTTTGTGGGCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000334.4-685s21c1
Sequence:CCGGTGGCGTACCTGACAGAGTTTGCTCGAGCAAACTCTGTCAGGTACGCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???