EMAIL THIS PAGE TO A FRIEND

SCN5A

sodium channel, voltage-gated, type V, alpha subunit

120 Gene Product Result for
Synonyms: CDCD2 CMD1E CMPD2 HB1 HB2 HBBD HH1 ICCD IVF LQT3 Nav1.5 PFHB1 SSS1 VF1
Gene ID:
Human(6331) Summary: The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(20271) sodium channel, voltage-gated, type V, alpha
Rat(25665) sodium channel, voltage-gated, type V, alpha subunit
chicken(395947) sodium channel, voltage-gated, type V, alpha subunit
domestic cat(101100994) sodium channel, voltage-gated, type V, alpha subunit
Horse(100034027) sodium channel, voltage-gated, type V, alpha subunit
dog(403497) sodium channel, voltage-gated, type V, alpha subunit
domestic guinea pig(100723340) sodium channel, voltage-gated, type V, alpha subunit
naked mole-rat(101710111) sodium channel, voltage-gated, type V, alpha subunit
Domestic Rabbit(100009516) sodium channel, voltage-gated, type V, alpha subunit
cow(282061) sodium channel, voltage-gated, type V, alpha subunit
sheep(101111582) sodium channel, voltage-gated, type V, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C8912 Cocaine free base human, mouse, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000335 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151881 MISSION® esiRNA esiRNA human SCN5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000335 Rosetta Predictions human pricing
NM_001099404 Rosetta Predictions human pricing
NM_001099405 Rosetta Predictions human pricing
NM_198056 Rosetta Predictions human pricing
NM_013125 Rosetta Predictions rat pricing
NM_021544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302352 predicted 2480
2 SASI_Hs01_00024074 predicted 4800
3 SASI_Hs01_00024075 predicted 2318
4 SASI_Hs02_00302353 predicted 4788
5 SASI_Hs01_00024076 predicted 2929
6 SASI_Hs01_00024077 predicted 4726
7 SASI_Hs02_00302354 predicted 5219
8 SASI_Hs01_00024078 predicted 2364
9 SASI_Hs01_00024079 predicted 1349
10 SASI_Hs01_00024080 predicted 6162
11 SASI_Hs01_00024081 predicted 782
12 SASI_Hs01_00024082 predicted 679
13 SASI_Hs01_00024083 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320569 predicted 2475
2 SASI_Hs02_00320570 predicted 4805
3 SASI_Hs02_00320571 predicted 2319
4 SASI_Hs02_00320572 predicted 4789
5 SASI_Hs02_00320573 predicted 2929
6 SASI_Hs02_00320574 predicted 4732
7 SASI_Hs02_00320575 predicted 5217
8 SASI_Hs02_00320576 predicted 2362
9 SASI_Hs02_00320577 predicted 1349
10 SASI_Hs02_00320578 predicted 6166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320579 predicted 2473
2 SASI_Hs02_00320580 predicted 4747
3 SASI_Hs02_00320581 predicted 2312
4 SASI_Hs02_00320582 predicted 4742
5 SASI_Hs02_00320583 predicted 2925
6 SASI_Hs02_00320584 predicted 4680
7 SASI_Hs02_00320585 predicted 5160
8 SASI_Hs02_00320586 predicted 2358
9 SASI_Hs02_00320587 predicted 1349
10 SASI_Hs02_00320588 predicted 6112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371611 predicted 2478
2 SASI_Hs01_00066047 predicted 4809
3 SASI_Hs01_00066048 predicted 2318
4 SASI_Hs02_00371612 predicted 4791
5 SASI_Hs01_00066049 predicted 2928
6 SASI_Hs01_00066050 predicted 4737
7 SASI_Hs02_00371613 predicted 5217
8 SASI_Hs01_00066051 predicted 2362
9 SASI_Hs01_00066052 predicted 1349
10 SASI_Hs01_00066053 predicted 6164
11 SASI_Hs01_00066054 predicted 779
12 SASI_Hs01_00066055 predicted 676
13 SASI_Hs01_00066056 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057297 predicted 4080
2 SASI_Rn01_00057298 predicted 4356
3 SASI_Rn01_00057299 predicted 1128
4 SASI_Rn02_00260906 predicted 1161
5 SASI_Rn01_00057300 predicted 5734
6 SASI_Rn01_00057301 predicted 4870
7 SASI_Rn01_00057303 predicted 4065
8 SASI_Rn01_00057304 predicted 2348
9 SASI_Rn01_00057305 predicted 5226
10 SASI_Rn01_00057306 predicted 2310
11 SASI_Rn01_00057302 predicted 2540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192957 predicted 2516
2 SASI_Mm01_00192958 predicted 2783
3 SASI_Mm01_00192959 predicted 2514
4 SASI_Mm01_00192960 predicted 1049
5 SASI_Mm01_00192961 predicted 5005
6 SASI_Mm01_00192962 predicted 1376
7 SASI_Mm01_00192964 predicted 3627
8 SASI_Mm01_00192966 predicted 807
9 SASI_Mm02_00326292 predicted 2327
10 SASI_Mm02_00326293 predicted 3844
11 SASI_Mm01_00192963 predicted 6331
12 SASI_Mm01_00192965 predicted 3975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021544
SCN5A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type V, alpha subunit
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021544.3-6586s21c1
Sequence:CCGGGAACAAGCTTTCATAGGTTTACTCGAGTAAACCTATGAAAGCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-984s1c1
Sequence:CCGGGCCAATTACCTACTCAAGAATCTCGAGATTCTTGAGTAGGTAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-3780s1c1
Sequence:CCGGGCCGACAAGATGTTCACCTATCTCGAGATAGGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-2360s1c1
Sequence:CCGGCCTTGACCCATACTACTACTTCTCGAGAAGTAGTAGTATGGGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-4607s1c1
Sequence:CCGGCCAGGGTTTCATATTCGACATCTCGAGATGTCGAATATGAAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-302s1c1
Sequence:CCGGCCCTTTCTATAGTACCCAGAACTCGAGTTCTGGGTACTATAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021544
SCN5A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type V, alpha subunit
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021544.3-6586s21c1
Sequence:CCGGGAACAAGCTTTCATAGGTTTACTCGAGTAAACCTATGAAAGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-984s1c1
Sequence:CCGGGCCAATTACCTACTCAAGAATCTCGAGATTCTTGAGTAGGTAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-3780s1c1
Sequence:CCGGGCCGACAAGATGTTCACCTATCTCGAGATAGGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-2360s1c1
Sequence:CCGGCCTTGACCCATACTACTACTTCTCGAGAAGTAGTAGTATGGGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-4607s1c1
Sequence:CCGGCCAGGGTTTCATATTCGACATCTCGAGATGTCGAATATGAAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-302s1c1
Sequence:CCGGCCCTTTCTATAGTACCCAGAACTCGAGTTCTGGGTACTATAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021544
SCN5A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type V, alpha subunit
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021544.3-6586s21c1
Sequence:CCGGGAACAAGCTTTCATAGGTTTACTCGAGTAAACCTATGAAAGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-984s1c1
Sequence:CCGGGCCAATTACCTACTCAAGAATCTCGAGATTCTTGAGTAGGTAATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-3780s1c1
Sequence:CCGGGCCGACAAGATGTTCACCTATCTCGAGATAGGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-2360s1c1
Sequence:CCGGCCTTGACCCATACTACTACTTCTCGAGAAGTAGTAGTATGGGTCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-4607s1c1
Sequence:CCGGCCAGGGTTTCATATTCGACATCTCGAGATGTCGAATATGAAACCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-302s1c1
Sequence:CCGGCCCTTTCTATAGTACCCAGAACTCGAGTTCTGGGTACTATAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000335
VALIDATED
SCN5A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type V, alpha subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2219s21c1
Sequence:CCGGGTTAGAGGAGTCTCGCCACAACTCGAGTTGTGGCGAGACTCCTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6131s21c1
Sequence:CCGGCACTAGAGCCACCAGCGATAACTCGAGTTATCGCTGGTGGCTCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-2733s1c1
Sequence:CCGGGCCATCATCGTGTTCATCTTTCTCGAGAAAGATGAACACGATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-3812s1c1
Sequence:CCGGCGAGACATTCATCATCTTCATCTCGAGATGAAGATGATGAATGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-3915s1c1
Sequence:CCGGGCCGACAAGATGTTCACATATCTCGAGATATGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-779s1c1
Sequence:CCGGGCTGGACTTTAGTGTGATTATCTCGAGATAATCACACTAAAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-5605s1c1
Sequence:CCGGCCACTCAGTTTATTGAGTATTCTCGAGAATACTCAATAAACTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2587s21c1
Sequence:CCGGTGTCCCGCATGAGCAACTTGTCTCGAGACAAGTTGCTCATGCGGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6182s21c1
Sequence:CCGGCAGTGAAGATCTCGCCGACTTCTCGAGAAGTCGGCGAGATCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-5894s21c1
Sequence:CCGGAGAGGTGTCGGCCATGGTTATCTCGAGATAACCATGGCCGACACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000335
VALIDATED
SCN5A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type V, alpha subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2219s21c1
Sequence:CCGGGTTAGAGGAGTCTCGCCACAACTCGAGTTGTGGCGAGACTCCTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6131s21c1
Sequence:CCGGCACTAGAGCCACCAGCGATAACTCGAGTTATCGCTGGTGGCTCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-2733s1c1
Sequence:CCGGGCCATCATCGTGTTCATCTTTCTCGAGAAAGATGAACACGATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-3812s1c1
Sequence:CCGGCGAGACATTCATCATCTTCATCTCGAGATGAAGATGATGAATGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-3915s1c1
Sequence:CCGGGCCGACAAGATGTTCACATATCTCGAGATATGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-779s1c1
Sequence:CCGGGCTGGACTTTAGTGTGATTATCTCGAGATAATCACACTAAAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-5605s1c1
Sequence:CCGGCCACTCAGTTTATTGAGTATTCTCGAGAATACTCAATAAACTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2587s21c1
Sequence:CCGGTGTCCCGCATGAGCAACTTGTCTCGAGACAAGTTGCTCATGCGGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6182s21c1
Sequence:CCGGCAGTGAAGATCTCGCCGACTTCTCGAGAAGTCGGCGAGATCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-5894s21c1
Sequence:CCGGAGAGGTGTCGGCCATGGTTATCTCGAGATAACCATGGCCGACACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000335
VALIDATED
SCN5A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type V, alpha subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2219s21c1
Sequence:CCGGGTTAGAGGAGTCTCGCCACAACTCGAGTTGTGGCGAGACTCCTCTAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6131s21c1
Sequence:CCGGCACTAGAGCCACCAGCGATAACTCGAGTTATCGCTGGTGGCTCTAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-2733s1c1
Sequence:CCGGGCCATCATCGTGTTCATCTTTCTCGAGAAAGATGAACACGATGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-3812s1c1
Sequence:CCGGCGAGACATTCATCATCTTCATCTCGAGATGAAGATGATGAATGTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-3915s1c1
Sequence:CCGGGCCGACAAGATGTTCACATATCTCGAGATATGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-779s1c1
Sequence:CCGGGCTGGACTTTAGTGTGATTATCTCGAGATAATCACACTAAAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-5605s1c1
Sequence:CCGGCCACTCAGTTTATTGAGTATTCTCGAGAATACTCAATAAACTGAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2587s21c1
Sequence:CCGGTGTCCCGCATGAGCAACTTGTCTCGAGACAAGTTGCTCATGCGGGACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6182s21c1
Sequence:CCGGCAGTGAAGATCTCGCCGACTTCTCGAGAAGTCGGCGAGATCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-5894s21c1
Sequence:CCGGAGAGGTGTCGGCCATGGTTATCTCGAGATAACCATGGCCGACACCTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)