EMAIL THIS PAGE TO A FRIEND

SCN5A

sodium channel, voltage-gated, type V, alpha subunit

275 Gene Product Result for
Synonyms: CDCD2 CMD1E CMPD2 HB1 HB2 HBBD HH1 ICCD IVF LQT3 Nav1.5 PFHB1 SSS1 VF1
Gene ID:
Human(6331) Summary: The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(20271) sodium channel, voltage-gated, type V, alpha
Rat(25665) sodium channel, voltage-gated, type V, alpha subunit
chicken(395947) sodium channel, voltage-gated, type V, alpha subunit
domestic cat(101100994) sodium channel, voltage-gated, type V, alpha subunit
Horse(100034027) sodium channel, voltage-gated, type V, alpha subunit
dog(403497) sodium channel, voltage-gated, type V, alpha subunit
domestic guinea pig(100723340) sodium channel, voltage-gated, type V, alpha subunit
naked mole-rat(101710111) sodium channel, voltage-gated, type V, alpha subunit
Domestic Rabbit(100009516) sodium channel, voltage-gated, type V, alpha subunit
cow(282061) sodium channel, voltage-gated, type V, alpha subunit
sheep(101111582) sodium channel, voltage-gated, type V, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
F-017 (±)-Flecainide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
UC177 (±)-Mephenytoin human pricing
SML1444 (±)-Mepivacaine hydrochloride ≥98% (HPLC) human pricing
PHL80964 (+)-Quinidine phyproof® Reference Substance human pricing
462047 1-(2,6-Dimethylphenoxy)-2-propanamine hydrochloride 97% human pricing
146668 2,4-Dichlorobenzyl alcohol 99% human pricing
Y0001620 2,4-Dichlorobenzyl alcohol European Pharmacopoeia (EP) Reference Standard human pricing
CDS021586 2-(Diethylamino)ethyl 4-amino-2-propoxybenzoate human pricing
D6658 5,5-Diphenylhydantoin solution drug standard, 1.0 mg/mL in methanol human pricing
1042918 Articaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML1093 Articaine hydrochloride ≥98% (HPLC) human pricing
Y0000079 Articaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1881 Articaine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B9050 Benoxinate hydrochloride meets USP testing specifications human pricing
1050009 Benoxinate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
B4386 Benoxinate hydrochloride ≥98% human pricing
94496 Carbamazepine analytical standard human pricing
PHR1067 Carbamazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1093001 Carbamazepine United States Pharmacopeia (USP) Reference Standard human pricing
C0450000 Carbamazepine European Pharmacopoeia (EP) Reference Standard human pricing
BP974 Carbamazepine British Pharmacopoeia (BP) Reference Standard human pricing
C-053 Carbamazepine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2177000 Cinchocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
D0638 Dibucaine hydrochloride analytical standard, ≥99% human pricing
1187003 Dibucaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
D2920000 Disopyramide European Pharmacopoeia (EP) Reference Standard human pricing
D7275 Disopyramide human pricing
1222501 Disopyramide phosphate United States Pharmacopeia (USP) Reference Standard human pricing
D2922000 Disopyramide phosphate European Pharmacopoeia (EP) Reference Standard human pricing
D6035 Disopyramide phosphate salt human pricing
D9696 Dronedarone hydrochloride ≥98% (HPLC) human pricing
1228530 Dronedarone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0002121 Dronedarone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1230000 Dyclonine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1849 Dyclonine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
E9156 Encainide hydrochloride ≥98% (HPLC), powder human pricing
1270800 Flecainide acetate United States Pharmacopeia (USP) Reference Standard human pricing
F0120000 Flecainide acetate European Pharmacopoeia (EP) Reference Standard human pricing
BP676 Flecainide acetate British Pharmacopoeia (BP) Reference Standard human pricing
F6777 Flecainide acetate salt human pricing
Y0001274 Flecainide for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-029 Lacosamide solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1392 Lamotrigine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1356756 Lamotrigine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001030 Lamotrigine European Pharmacopoeia (EP) Reference Standard human pricing
BP1097 Lamotrigine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001031 Lamotrigine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001085 Lamotrigine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-019 Lamotrigine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1034 Lidocaine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366002 Lidocaine United States Pharmacopeia (USP) Reference Standard human pricing
L0595000 Lidocaine European Pharmacopoeia (EP) Reference Standard human pricing
BP727 Lidocaine British Pharmacopoeia (BP) Reference Standard human pricing
PHR1257 Lidocaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366013 Lidocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0600000 Lidocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP214 Lidocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
L5647 Lidocaine hydrochloride monohydrate solid human pricing
L-018 Lidocaine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1385007 Mephenytoin United States Pharmacopeia (USP) Reference Standard human pricing
1387002 Mepivacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1955 Mepivacaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M0370000 Mepivacaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
M3189 Mepivacaine hydrochloride 98.0-102.0%, meets USP testing specifications human pricing
BP699 Mepivacaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
M2727 Mexiletine hydrochloride powder human pricing
1443250 Mexiletine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1860000 Mexiletine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001181 Orphenadrine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
75517 Orphenadrine hydrochloride ≥98.0% (AT) human pricing
Y0000100 Orphenadrine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1635 Oxcarbazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
19532 Oxcarbazepine analytical standard human pricing
1483152 Oxcarbazepine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001576 Oxcarbazepine European Pharmacopoeia (EP) Reference Standard human pricing
O-025 Oxcarbazepine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O0270000 Oxybuprocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP700 Oxybuprocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
34076 Phenazopyridine hydrochloride VETRANAL®, analytical standard human pricing
1515000 Phenazopyridine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1139 Phenytoin Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535008 Phenytoin United States Pharmacopeia (USP) Reference Standard human pricing
P1290000 Phenytoin European Pharmacopoeia (EP) Reference Standard human pricing
Y0001167 Phenytoin for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1492 Phenytoin sodium Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535507 Phenytoin sodium United States Pharmacopeia (USP) Reference Standard human pricing
P1300000 Phenytoin sodium European Pharmacopoeia (EP) Reference Standard human pricing
BP1238 Phenytoin sodium British Pharmacopoeia (BP) Reference Standard human pricing
P-063 Phenytoin solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001681 Prilocaine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P9547 Prilocaine hydrochloride ≥98% (TLC) human pricing
P3347 Prilocaine hydrochloride meets USP testing specifications human pricing
1561008 Prilocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P2939060 Prilocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP497 Prilocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1252 Procainamide hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1563502 Procainamide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML2088 Procainamide hydrochloride ≥98% (HPLC) human pricing
P3050000 Procainamide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P9391 Procainamide hydrochloride human pricing
81664 Procainamide hydrochloride purum, ≥98.0% (AT) human pricing
P9879 Procaine hydrochloride ≥97% human pricing
1564006 Procaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1161 Procaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
46608 Procaine hydrochloride VETRANAL®, analytical standard human pricing
P3100000 Procaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1571001 Proparacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P4554 Proparacaine hydrochloride analytical standard human pricing
1595000 Quinidine gluconate United States Pharmacopeia (USP) Reference Standard human pricing
Q5001 Quinidine gluconate salt analytical standard human pricing
Q0750 Quinidine hydrochloride monohydrate technical grade human pricing
R6152 Ranolazine dihydrochloride ≥98% (HPLC), powder human pricing
1604337 Riluzole United States Pharmacopeia (USP) Reference Standard human pricing
R8404 Rufinamide ≥98% (HPLC), powder human pricing
PHR1625 Rufinamide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1606401 Rufinamide United States Pharmacopeia (USP) Reference Standard human pricing
T7383 Tetracaine ≥98% (TLC) human pricing
1649991 Tetracaine United States Pharmacopeia (USP) Reference Standard human pricing
T3812 Tetracaine meets USP testing specifications human pricing
Y0002117 Tetracaine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001002 Tetracaine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T7508 Tetracaine hydrochloride ≥99% human pricing
PHR1129 Tetracaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1650006 Tetracaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T0500000 Tetracaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T3937 Tetracaine hydrochloride meets USP testing specifications human pricing
T7645 Tetracaine hydrochloride Sigma Reference Standard human pricing
T0202 Tocainide hydrochloride ≥98% (HPLC), solid human pricing
1667552 Tocainide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Z2001 Zonisamide sodium salt ≥98% (HPLC), powder human pricing
Z-005 Zonisamide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D4007 5,5-Diphenylhydantoin ≥98% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
B5435 BIA 2-093 ≥98% (HPLC), solid human, rat pricing
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
L7757 Lidocaine powder human, rat pricing
L1026 Lidocaine analytical standard human, rat pricing
O3764 Oxcarbazepine ≥98% (HPLC), solid human, rat pricing
R116 Riluzole solid human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C8912 Cocaine free base human, mouse, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000335 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151881 MISSION® esiRNA esiRNA human SCN5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000335 Rosetta Predictions human pricing
NM_001099404 Rosetta Predictions human pricing
NM_001099405 Rosetta Predictions human pricing
NM_198056 Rosetta Predictions human pricing
NM_013125 Rosetta Predictions rat pricing
NM_021544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302352 predicted 2480
2 SASI_Hs01_00024074 predicted 4800
3 SASI_Hs01_00024075 predicted 2318
4 SASI_Hs02_00302353 predicted 4788
5 SASI_Hs01_00024076 predicted 2929
6 SASI_Hs01_00024077 predicted 4726
7 SASI_Hs02_00302354 predicted 5219
8 SASI_Hs01_00024078 predicted 2364
9 SASI_Hs01_00024079 predicted 1349
10 SASI_Hs01_00024080 predicted 6162
11 SASI_Hs01_00024081 predicted 782
12 SASI_Hs01_00024082 predicted 679
13 SASI_Hs01_00024083 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320569 predicted 2475
2 SASI_Hs02_00320570 predicted 4805
3 SASI_Hs02_00320571 predicted 2319
4 SASI_Hs02_00320572 predicted 4789
5 SASI_Hs02_00320573 predicted 2929
6 SASI_Hs02_00320574 predicted 4732
7 SASI_Hs02_00320575 predicted 5217
8 SASI_Hs02_00320576 predicted 2362
9 SASI_Hs02_00320577 predicted 1349
10 SASI_Hs02_00320578 predicted 6166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320579 predicted 2473
2 SASI_Hs02_00320580 predicted 4747
3 SASI_Hs02_00320581 predicted 2312
4 SASI_Hs02_00320582 predicted 4742
5 SASI_Hs02_00320583 predicted 2925
6 SASI_Hs02_00320584 predicted 4680
7 SASI_Hs02_00320585 predicted 5160
8 SASI_Hs02_00320586 predicted 2358
9 SASI_Hs02_00320587 predicted 1349
10 SASI_Hs02_00320588 predicted 6112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371611 predicted 2478
2 SASI_Hs01_00066047 predicted 4809
3 SASI_Hs01_00066048 predicted 2318
4 SASI_Hs02_00371612 predicted 4791
5 SASI_Hs01_00066049 predicted 2928
6 SASI_Hs01_00066050 predicted 4737
7 SASI_Hs02_00371613 predicted 5217
8 SASI_Hs01_00066051 predicted 2362
9 SASI_Hs01_00066052 predicted 1349
10 SASI_Hs01_00066053 predicted 6164
11 SASI_Hs01_00066054 predicted 779
12 SASI_Hs01_00066055 predicted 676
13 SASI_Hs01_00066056 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057297 predicted 4080
2 SASI_Rn01_00057298 predicted 4356
3 SASI_Rn01_00057299 predicted 1128
4 SASI_Rn02_00260906 predicted 1161
5 SASI_Rn01_00057300 predicted 5734
6 SASI_Rn01_00057301 predicted 4870
7 SASI_Rn01_00057303 predicted 4065
8 SASI_Rn01_00057304 predicted 2348
9 SASI_Rn01_00057305 predicted 5226
10 SASI_Rn01_00057306 predicted 2310
11 SASI_Rn01_00057302 predicted 2540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192957 predicted 2516
2 SASI_Mm01_00192958 predicted 2783
3 SASI_Mm01_00192959 predicted 2514
4 SASI_Mm01_00192960 predicted 1049
5 SASI_Mm01_00192961 predicted 5005
6 SASI_Mm01_00192962 predicted 1376
7 SASI_Mm01_00192964 predicted 3627
8 SASI_Mm01_00192966 predicted 807
9 SASI_Mm02_00326292 predicted 2327
10 SASI_Mm02_00326293 predicted 3844
11 SASI_Mm01_00192963 predicted 6331
12 SASI_Mm01_00192965 predicted 3975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021544
SCN5A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type V, alpha subunit
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021544.3-6586s21c1
Sequence:CCGGGAACAAGCTTTCATAGGTTTACTCGAGTAAACCTATGAAAGCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-984s1c1
Sequence:CCGGGCCAATTACCTACTCAAGAATCTCGAGATTCTTGAGTAGGTAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-3780s1c1
Sequence:CCGGGCCGACAAGATGTTCACCTATCTCGAGATAGGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-2360s1c1
Sequence:CCGGCCTTGACCCATACTACTACTTCTCGAGAAGTAGTAGTATGGGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-4607s1c1
Sequence:CCGGCCAGGGTTTCATATTCGACATCTCGAGATGTCGAATATGAAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-302s1c1
Sequence:CCGGCCCTTTCTATAGTACCCAGAACTCGAGTTCTGGGTACTATAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021544
SCN5A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type V, alpha subunit
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021544.3-6586s21c1
Sequence:CCGGGAACAAGCTTTCATAGGTTTACTCGAGTAAACCTATGAAAGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-984s1c1
Sequence:CCGGGCCAATTACCTACTCAAGAATCTCGAGATTCTTGAGTAGGTAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-3780s1c1
Sequence:CCGGGCCGACAAGATGTTCACCTATCTCGAGATAGGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-2360s1c1
Sequence:CCGGCCTTGACCCATACTACTACTTCTCGAGAAGTAGTAGTATGGGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-4607s1c1
Sequence:CCGGCCAGGGTTTCATATTCGACATCTCGAGATGTCGAATATGAAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-302s1c1
Sequence:CCGGCCCTTTCTATAGTACCCAGAACTCGAGTTCTGGGTACTATAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021544
SCN5A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type V, alpha subunit
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021544.3-6586s21c1
Sequence:CCGGGAACAAGCTTTCATAGGTTTACTCGAGTAAACCTATGAAAGCTTGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-984s1c1
Sequence:CCGGGCCAATTACCTACTCAAGAATCTCGAGATTCTTGAGTAGGTAATTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-3780s1c1
Sequence:CCGGGCCGACAAGATGTTCACCTATCTCGAGATAGGTGAACATCTTGTCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-2360s1c1
Sequence:CCGGCCTTGACCCATACTACTACTTCTCGAGAAGTAGTAGTATGGGTCAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-4607s1c1
Sequence:CCGGCCAGGGTTTCATATTCGACATCTCGAGATGTCGAATATGAAACCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021544.1-302s1c1
Sequence:CCGGCCCTTTCTATAGTACCCAGAACTCGAGTTCTGGGTACTATAGAAAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000335
VALIDATED
SCN5A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type V, alpha subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2219s21c1
Sequence:CCGGGTTAGAGGAGTCTCGCCACAACTCGAGTTGTGGCGAGACTCCTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6131s21c1
Sequence:CCGGCACTAGAGCCACCAGCGATAACTCGAGTTATCGCTGGTGGCTCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-2733s1c1
Sequence:CCGGGCCATCATCGTGTTCATCTTTCTCGAGAAAGATGAACACGATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-3812s1c1
Sequence:CCGGCGAGACATTCATCATCTTCATCTCGAGATGAAGATGATGAATGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-3915s1c1
Sequence:CCGGGCCGACAAGATGTTCACATATCTCGAGATATGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-779s1c1
Sequence:CCGGGCTGGACTTTAGTGTGATTATCTCGAGATAATCACACTAAAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-5605s1c1
Sequence:CCGGCCACTCAGTTTATTGAGTATTCTCGAGAATACTCAATAAACTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2587s21c1
Sequence:CCGGTGTCCCGCATGAGCAACTTGTCTCGAGACAAGTTGCTCATGCGGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6182s21c1
Sequence:CCGGCAGTGAAGATCTCGCCGACTTCTCGAGAAGTCGGCGAGATCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-5894s21c1
Sequence:CCGGAGAGGTGTCGGCCATGGTTATCTCGAGATAACCATGGCCGACACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000335
VALIDATED
SCN5A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type V, alpha subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2219s21c1
Sequence:CCGGGTTAGAGGAGTCTCGCCACAACTCGAGTTGTGGCGAGACTCCTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6131s21c1
Sequence:CCGGCACTAGAGCCACCAGCGATAACTCGAGTTATCGCTGGTGGCTCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-2733s1c1
Sequence:CCGGGCCATCATCGTGTTCATCTTTCTCGAGAAAGATGAACACGATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-3812s1c1
Sequence:CCGGCGAGACATTCATCATCTTCATCTCGAGATGAAGATGATGAATGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-3915s1c1
Sequence:CCGGGCCGACAAGATGTTCACATATCTCGAGATATGTGAACATCTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-779s1c1
Sequence:CCGGGCTGGACTTTAGTGTGATTATCTCGAGATAATCACACTAAAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-5605s1c1
Sequence:CCGGCCACTCAGTTTATTGAGTATTCTCGAGAATACTCAATAAACTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2587s21c1
Sequence:CCGGTGTCCCGCATGAGCAACTTGTCTCGAGACAAGTTGCTCATGCGGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6182s21c1
Sequence:CCGGCAGTGAAGATCTCGCCGACTTCTCGAGAAGTCGGCGAGATCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-5894s21c1
Sequence:CCGGAGAGGTGTCGGCCATGGTTATCTCGAGATAACCATGGCCGACACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000335
VALIDATED
SCN5A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type V, alpha subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2219s21c1
Sequence:CCGGGTTAGAGGAGTCTCGCCACAACTCGAGTTGTGGCGAGACTCCTCTAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6131s21c1
Sequence:CCGGCACTAGAGCCACCAGCGATAACTCGAGTTATCGCTGGTGGCTCTAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-2733s1c1
Sequence:CCGGGCCATCATCGTGTTCATCTTTCTCGAGAAAGATGAACACGATGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-3812s1c1
Sequence:CCGGCGAGACATTCATCATCTTCATCTCGAGATGAAGATGATGAATGTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-3915s1c1
Sequence:CCGGGCCGACAAGATGTTCACATATCTCGAGATATGTGAACATCTTGTCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000335.3-779s1c1
Sequence:CCGGGCTGGACTTTAGTGTGATTATCTCGAGATAATCACACTAAAGTCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000335.3-5605s1c1
Sequence:CCGGCCACTCAGTTTATTGAGTATTCTCGAGAATACTCAATAAACTGAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000444826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-2587s21c1
Sequence:CCGGTGTCCCGCATGAGCAACTTGTCTCGAGACAAGTTGCTCATGCGGGACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-6182s21c1
Sequence:CCGGCAGTGAAGATCTCGCCGACTTCTCGAGAAGTCGGCGAGATCTTCACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000335.4-5894s21c1
Sequence:CCGGAGAGGTGTCGGCCATGGTTATCTCGAGATAACCATGGCCGACACCTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???