EMAIL THIS PAGE TO A FRIEND

SCN7A

sodium channel, voltage-gated, type VII, alpha subunit

193 Gene Product Result for
Synonyms: NaG Nav2.1 Nav2.2 SCN6A
UniProtKB ID: Q01118
Gene ID:
Human(6332) Summary: This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
Mouse(20272) sodium channel, voltage-gated, type VII, alpha
Rat(64155) sodium channel, voltage-gated, type VII, alpha
cow(507516) sodium channel, voltage-gated, type VII, alpha subunit
sheep(101109522) sodium channel, voltage-gated, type VII, alpha subunit
naked mole-rat(101711842) sodium channel, voltage-gated, type VII, alpha subunit
domestic guinea pig(100715553) sodium channel, voltage-gated, type VII, alpha subunit
Horse(100062186) sodium channel, voltage-gated, type VII, alpha subunit
domestic cat(101082080) sodium channel, voltage-gated, type VII, alpha subunit
dog(488382) sodium channel, voltage-gated, type VII, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
UC177 (±)-Mephenytoin human pricing
SML1444 (±)-Mepivacaine hydrochloride ≥98% (HPLC) human pricing
PHL80964 (+)-Quinidine phyproof® Reference Substance human pricing
462047 1-(2,6-Dimethylphenoxy)-2-propanamine hydrochloride 97% human pricing
146668 2,4-Dichlorobenzyl alcohol 99% human pricing
Y0001620 2,4-Dichlorobenzyl alcohol European Pharmacopoeia (EP) Reference Standard human pricing
CDS021586 2-(Diethylamino)ethyl 4-amino-2-propoxybenzoate human pricing
D6658 5,5-Diphenylhydantoin solution drug standard, 1.0 mg/mL in methanol human pricing
1042918 Articaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML1093 Articaine hydrochloride ≥98% (HPLC) human pricing
Y0000079 Articaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1881 Articaine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B9050 Benoxinate hydrochloride meets USP testing specifications human pricing
1050009 Benoxinate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
B4386 Benoxinate hydrochloride ≥98% human pricing
94496 Carbamazepine analytical standard human pricing
PHR1067 Carbamazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1093001 Carbamazepine United States Pharmacopeia (USP) Reference Standard human pricing
C0450000 Carbamazepine European Pharmacopoeia (EP) Reference Standard human pricing
BP974 Carbamazepine British Pharmacopoeia (BP) Reference Standard human pricing
C-053 Carbamazepine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
D2920000 Disopyramide European Pharmacopoeia (EP) Reference Standard human pricing
D7275 Disopyramide human pricing
1222501 Disopyramide phosphate United States Pharmacopeia (USP) Reference Standard human pricing
D2922000 Disopyramide phosphate European Pharmacopoeia (EP) Reference Standard human pricing
D6035 Disopyramide phosphate salt human pricing
D9696 Dronedarone hydrochloride ≥98% (HPLC) human pricing
1228530 Dronedarone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0002121 Dronedarone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1230000 Dyclonine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1849 Dyclonine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
E9156 Encainide hydrochloride ≥98% (HPLC), powder human pricing
L-029 Lacosamide solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1392 Lamotrigine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1356756 Lamotrigine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001030 Lamotrigine European Pharmacopoeia (EP) Reference Standard human pricing
BP1097 Lamotrigine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001031 Lamotrigine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001085 Lamotrigine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-019 Lamotrigine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1034 Lidocaine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366002 Lidocaine United States Pharmacopeia (USP) Reference Standard human pricing
L0595000 Lidocaine European Pharmacopoeia (EP) Reference Standard human pricing
BP727 Lidocaine British Pharmacopoeia (BP) Reference Standard human pricing
PHR1257 Lidocaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366013 Lidocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0600000 Lidocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP214 Lidocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
L5647 Lidocaine hydrochloride monohydrate solid human pricing
L-018 Lidocaine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1385007 Mephenytoin United States Pharmacopeia (USP) Reference Standard human pricing
1387002 Mepivacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1955 Mepivacaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M0370000 Mepivacaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
M3189 Mepivacaine hydrochloride 98.0-102.0%, meets USP testing specifications human pricing
BP699 Mepivacaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
M2727 Mexiletine hydrochloride powder human pricing
1443250 Mexiletine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1860000 Mexiletine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001181 Orphenadrine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
75517 Orphenadrine hydrochloride ≥98.0% (AT) human pricing
Y0000100 Orphenadrine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1635 Oxcarbazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
19532 Oxcarbazepine analytical standard human pricing
1483152 Oxcarbazepine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001576 Oxcarbazepine European Pharmacopoeia (EP) Reference Standard human pricing
O-025 Oxcarbazepine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O0270000 Oxybuprocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP700 Oxybuprocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
34076 Phenazopyridine hydrochloride VETRANAL®, analytical standard human pricing
1515000 Phenazopyridine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1139 Phenytoin Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535008 Phenytoin United States Pharmacopeia (USP) Reference Standard human pricing
P1290000 Phenytoin European Pharmacopoeia (EP) Reference Standard human pricing
Y0001167 Phenytoin for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1492 Phenytoin sodium Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535507 Phenytoin sodium United States Pharmacopeia (USP) Reference Standard human pricing
P1300000 Phenytoin sodium European Pharmacopoeia (EP) Reference Standard human pricing
BP1238 Phenytoin sodium British Pharmacopoeia (BP) Reference Standard human pricing
P-063 Phenytoin solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001681 Prilocaine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P9547 Prilocaine hydrochloride ≥98% (TLC) human pricing
P3347 Prilocaine hydrochloride meets USP testing specifications human pricing
1561008 Prilocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P2939060 Prilocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP497 Prilocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1252 Procainamide hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1563502 Procainamide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML2088 Procainamide hydrochloride ≥98% (HPLC) human pricing
P3050000 Procainamide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P9391 Procainamide hydrochloride human pricing
81664 Procainamide hydrochloride purum, ≥98.0% (AT) human pricing
P9879 Procaine hydrochloride ≥97% human pricing
1564006 Procaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1161 Procaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
46608 Procaine hydrochloride VETRANAL®, analytical standard human pricing
P3100000 Procaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1571001 Proparacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P4554 Proparacaine hydrochloride analytical standard human pricing
1595000 Quinidine gluconate United States Pharmacopeia (USP) Reference Standard human pricing
Q5001 Quinidine gluconate salt analytical standard human pricing
Q0750 Quinidine hydrochloride monohydrate technical grade human pricing
1604337 Riluzole United States Pharmacopeia (USP) Reference Standard human pricing
R8404 Rufinamide ≥98% (HPLC), powder human pricing
PHR1625 Rufinamide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1606401 Rufinamide United States Pharmacopeia (USP) Reference Standard human pricing
T7383 Tetracaine ≥98% (TLC) human pricing
1649991 Tetracaine United States Pharmacopeia (USP) Reference Standard human pricing
T3812 Tetracaine meets USP testing specifications human pricing
Y0002117 Tetracaine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001002 Tetracaine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T7508 Tetracaine hydrochloride ≥99% human pricing
PHR1129 Tetracaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1650006 Tetracaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T0500000 Tetracaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T3937 Tetracaine hydrochloride meets USP testing specifications human pricing
T7645 Tetracaine hydrochloride Sigma Reference Standard human pricing
T0202 Tocainide hydrochloride ≥98% (HPLC), solid human pricing
1667552 Tocainide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Z2001 Zonisamide sodium salt ≥98% (HPLC), powder human pricing
Z-005 Zonisamide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D4007 5,5-Diphenylhydantoin ≥98% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
B5435 BIA 2-093 ≥98% (HPLC), solid human, rat pricing
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing
L7757 Lidocaine powder human, rat pricing
L1026 Lidocaine analytical standard human, rat pricing
O3764 Oxcarbazepine ≥98% (HPLC), solid human, rat pricing
R116 Riluzole solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002976 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058071 MISSION® esiRNA esiRNA targeting mouse Scn7a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002976 Rosetta Predictions human pricing
NM_031686 Rosetta Predictions rat pricing
NM_009135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113387 predicted 2919
2 SASI_Hs01_00113389 predicted 1535
3 SASI_Hs01_00113390 predicted 4117
4 SASI_Hs01_00113391 predicted 675
5 SASI_Hs02_00334848 predicted 2191
6 SASI_Hs02_00334849 predicted 2682
7 SASI_Hs01_00113392 predicted 3100
8 SASI_Hs01_00113394 predicted 3741
9 SASI_Hs01_00113395 predicted 3335
10 SASI_Hs01_00113396 predicted 4159
11 SASI_Hs01_00113388 predicted 2742
12 SASI_Hs01_00113393 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076155 predicted 3682
2 SASI_Rn01_00076156 predicted 2426
3 SASI_Rn01_00076157 predicted 4021
4 SASI_Rn01_00076158 predicted 5007
5 SASI_Rn01_00076159 predicted 4669
6 SASI_Rn01_00076160 predicted 461
7 SASI_Rn01_00076161 predicted 2259
8 SASI_Rn01_00076162 predicted 501
9 SASI_Rn02_00265030 predicted 2568
10 SASI_Rn01_00076163 predicted 1060
11 SASI_Rn01_00076164 predicted 5182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315428 predicted 2708
2 SASI_Mm01_00193680 predicted 2034
3 SASI_Mm01_00193681 predicted 4924
4 SASI_Mm02_00315429 predicted 5239
5 SASI_Mm01_00193684 predicted 3306
6 SASI_Mm01_00193685 predicted 709
7 SASI_Mm01_00193686 predicted 834
8 SASI_Mm01_00193688 predicted 1574
9 SASI_Mm01_00193689 predicted 1371
10 SASI_Mm02_00315430 predicted 1881
11 SASI_Mm01_00193682 predicted 2373
12 SASI_Mm01_00193683 predicted 3236
13 SASI_Mm01_00193687 predicted 4840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002976
SCN7A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type VII, alpha subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1901s21c1
Sequence:CCGGATGGCTCTTCTTCGATTATTCCTCGAGGAATAATCGAAGAAGAGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-687s21c1
Sequence:CCGGTAACTGTGTTTGAGGTTATTACTCGAGTAATAACCTCAAACACAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1613s21c1
Sequence:CCGGGAGTTTGTCCATAGGATTATACTCGAGTATAATCCTATGGACAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1156s21c1
Sequence:CCGGATTTGCCCTATTTCGGTTAATCTCGAGATTAACCGAAATAGGGCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-4270s1c1
Sequence:CCGGCCCAGCATTATTGAACATCATCTCGAGATGATGTTCAATAATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-523s1c1
Sequence:CCGGCCTGATTGATTGCGTATTCATCTCGAGATGAATACGCAATCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-3050s1c1
Sequence:CCGGGCTGACATGATCTTTACTTATCTCGAGATAAGTAAAGATCATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-5028s1c1
Sequence:CCGGCCATCATTCAACGTGCTTATACTCGAGTATAAGCACGTTGAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-1552s1c1
Sequence:CCGGCCCATTATACTGGTATAAGTTCTCGAGAACTTATACCAGTATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-3820s21c1
Sequence:CCGGACCAGTACCTCGCCCATTAAACTCGAGTTTAATGGGCGAGGTACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002976
SCN7A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type VII, alpha subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1901s21c1
Sequence:CCGGATGGCTCTTCTTCGATTATTCCTCGAGGAATAATCGAAGAAGAGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-687s21c1
Sequence:CCGGTAACTGTGTTTGAGGTTATTACTCGAGTAATAACCTCAAACACAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1613s21c1
Sequence:CCGGGAGTTTGTCCATAGGATTATACTCGAGTATAATCCTATGGACAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1156s21c1
Sequence:CCGGATTTGCCCTATTTCGGTTAATCTCGAGATTAACCGAAATAGGGCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-4270s1c1
Sequence:CCGGCCCAGCATTATTGAACATCATCTCGAGATGATGTTCAATAATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-523s1c1
Sequence:CCGGCCTGATTGATTGCGTATTCATCTCGAGATGAATACGCAATCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-3050s1c1
Sequence:CCGGGCTGACATGATCTTTACTTATCTCGAGATAAGTAAAGATCATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-5028s1c1
Sequence:CCGGCCATCATTCAACGTGCTTATACTCGAGTATAAGCACGTTGAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-1552s1c1
Sequence:CCGGCCCATTATACTGGTATAAGTTCTCGAGAACTTATACCAGTATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-3820s21c1
Sequence:CCGGACCAGTACCTCGCCCATTAAACTCGAGTTTAATGGGCGAGGTACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002976
SCN7A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type VII, alpha subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1901s21c1
Sequence:CCGGATGGCTCTTCTTCGATTATTCCTCGAGGAATAATCGAAGAAGAGCCATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-687s21c1
Sequence:CCGGTAACTGTGTTTGAGGTTATTACTCGAGTAATAACCTCAAACACAGTTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1613s21c1
Sequence:CCGGGAGTTTGTCCATAGGATTATACTCGAGTATAATCCTATGGACAAACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-1156s21c1
Sequence:CCGGATTTGCCCTATTTCGGTTAATCTCGAGATTAACCGAAATAGGGCAAATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-4270s1c1
Sequence:CCGGCCCAGCATTATTGAACATCATCTCGAGATGATGTTCAATAATGCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-523s1c1
Sequence:CCGGCCTGATTGATTGCGTATTCATCTCGAGATGAATACGCAATCAATCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-3050s1c1
Sequence:CCGGGCTGACATGATCTTTACTTATCTCGAGATAAGTAAAGATCATGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-5028s1c1
Sequence:CCGGCCATCATTCAACGTGCTTATACTCGAGTATAAGCACGTTGAATGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002976.1-1552s1c1
Sequence:CCGGCCCATTATACTGGTATAAGTTCTCGAGAACTTATACCAGTATAATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002976.2-3820s21c1
Sequence:CCGGACCAGTACCTCGCCCATTAAACTCGAGTTTAATGGGCGAGGTACTGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009135
SCN7A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type VII, alpha subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-3410s1c1
Sequence:CCGGGCGTGTTTCTAGTCTGCCTAACTCGAGTTAGGCAGACTAGAAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-3889s1c1
Sequence:CCGGGCCCTGAAGAAGCTCTTGTATCTCGAGATACAAGAGCTTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-1184s1c1
Sequence:CCGGCGGAAGGTTATGTGTGTGTAACTCGAGTTACACACACATAACCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-1647s1c1
Sequence:CCGGCCCAATATGTTGGCATAAGTTCTCGAGAACTTATGCCAACATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-5254s1c1
Sequence:CCGGGCATCTATTCAGACCCAGATTCTCGAGAATCTGGGTCTGAATAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009135
SCN7A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type VII, alpha subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-3410s1c1
Sequence:CCGGGCGTGTTTCTAGTCTGCCTAACTCGAGTTAGGCAGACTAGAAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-3889s1c1
Sequence:CCGGGCCCTGAAGAAGCTCTTGTATCTCGAGATACAAGAGCTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-1184s1c1
Sequence:CCGGCGGAAGGTTATGTGTGTGTAACTCGAGTTACACACACATAACCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-1647s1c1
Sequence:CCGGCCCAATATGTTGGCATAAGTTCTCGAGAACTTATGCCAACATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-5254s1c1
Sequence:CCGGGCATCTATTCAGACCCAGATTCTCGAGAATCTGGGTCTGAATAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009135
SCN7A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type VII, alpha subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-3410s1c1
Sequence:CCGGGCGTGTTTCTAGTCTGCCTAACTCGAGTTAGGCAGACTAGAAACACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-3889s1c1
Sequence:CCGGGCCCTGAAGAAGCTCTTGTATCTCGAGATACAAGAGCTTCTTCAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-1184s1c1
Sequence:CCGGCGGAAGGTTATGTGTGTGTAACTCGAGTTACACACACATAACCTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-1647s1c1
Sequence:CCGGCCCAATATGTTGGCATAAGTTCTCGAGAACTTATGCCAACATATTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009135.1-5254s1c1
Sequence:CCGGGCATCTATTCAGACCCAGATTCTCGAGAATCTGGGTCTGAATAGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???