EMAIL THIS PAGE TO A FRIEND

SCN8A

sodium channel, voltage gated, type VIII, alpha subunit

297 Gene Product Result for
Synonyms: CERIII CIAT EIEE13 MED NaCh6 Nav1.6 PN4
UniProtKB ID: Q9UQD0, B9VWG8, O95788, Q9NYX2, Q9UPB2
Gene ID:
Human(6334) Summary: This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(20273) sodium channel, voltage-gated, type VIII, alpha
Rat(29710) sodium channel, voltage gated, type VIII, alpha subunit
chicken(426869) sodium channel, voltage gated, type VIII, alpha subunit
chicken(100857835) sodium channel, voltage gated, type VIII, alpha subunit
Horse(100052777) sodium channel, voltage gated, type VIII, alpha subunit
domestic cat(101096578) sodium channel, voltage gated, type VIII, alpha subunit
dog(477604) sodium channel, voltage gated, type VIII, alpha subunit
domestic guinea pig(100734003) sodium channel, voltage gated, type VIII, alpha subunit
naked mole-rat(101711868) sodium channel, voltage gated, type VIII, alpha subunit
cow(537277) sodium channel, voltage gated, type VIII, alpha subunit
sheep(101113744) sodium channel, voltage gated, type VIII, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108709 Anti-SCN8A affinity isolated antibody bovine, rat, rabbit, guinea pig, horse, mouse, dog, human
western blot pricing
SAB2102092 Anti-SCN8A antibody produced in rabbit affinity isolated antibody horse, mouse, human, guinea pig, rat, canine, rabbit
western blot pricing
AB5580 Anti-SCN8A Sodium Channel Antibody clone, Chemicon®, from rabbit mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
S0438 Anti-Sodium Channel PN4 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
western blot pricing
WH0006334M4 Monoclonal Anti-SCN8A antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, western blot pricing
S8809 Monoclonal Anti-Sodium Channel, Pan antibody produced in mouse ~1 mg/mL, clone K58/35, purified immunoglobulin mammals
immunofluorescence, immunohistochemistry, western blot pricing

Small Molecule - Activator

Product # Description Species Add to Cart
 
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
UC177 (±)-Mephenytoin human pricing
SML1444 (±)-Mepivacaine hydrochloride ≥98% (HPLC) human pricing
PHL80964 (+)-Quinidine phyproof® Reference Substance human pricing
462047 1-(2,6-Dimethylphenoxy)-2-propanamine hydrochloride 97% human pricing
146668 2,4-Dichlorobenzyl alcohol 99% human pricing
Y0001620 2,4-Dichlorobenzyl alcohol European Pharmacopoeia (EP) Reference Standard human pricing
CDS021586 2-(Diethylamino)ethyl 4-amino-2-propoxybenzoate human pricing
D6658 5,5-Diphenylhydantoin solution drug standard, 1.0 mg/mL in methanol human pricing
1042918 Articaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML1093 Articaine hydrochloride ≥98% (HPLC) human pricing
Y0000079 Articaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1881 Articaine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B9050 Benoxinate hydrochloride meets USP testing specifications human pricing
1050009 Benoxinate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
B4386 Benoxinate hydrochloride ≥98% human pricing
94496 Carbamazepine analytical standard human pricing
PHR1067 Carbamazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1093001 Carbamazepine United States Pharmacopeia (USP) Reference Standard human pricing
C0450000 Carbamazepine European Pharmacopoeia (EP) Reference Standard human pricing
BP974 Carbamazepine British Pharmacopoeia (BP) Reference Standard human pricing
C-053 Carbamazepine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
D2920000 Disopyramide European Pharmacopoeia (EP) Reference Standard human pricing
D7275 Disopyramide human pricing
1222501 Disopyramide phosphate United States Pharmacopeia (USP) Reference Standard human pricing
D2922000 Disopyramide phosphate European Pharmacopoeia (EP) Reference Standard human pricing
D6035 Disopyramide phosphate salt human pricing
D9696 Dronedarone hydrochloride ≥98% (HPLC) human pricing
1228530 Dronedarone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0002121 Dronedarone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1230000 Dyclonine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1849 Dyclonine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
E9156 Encainide hydrochloride ≥98% (HPLC), powder human pricing
L-029 Lacosamide solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1392 Lamotrigine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1356756 Lamotrigine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001030 Lamotrigine European Pharmacopoeia (EP) Reference Standard human pricing
BP1097 Lamotrigine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001031 Lamotrigine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001085 Lamotrigine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-019 Lamotrigine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1034 Lidocaine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366002 Lidocaine United States Pharmacopeia (USP) Reference Standard human pricing
L0595000 Lidocaine European Pharmacopoeia (EP) Reference Standard human pricing
BP727 Lidocaine British Pharmacopoeia (BP) Reference Standard human pricing
PHR1257 Lidocaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366013 Lidocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0600000 Lidocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP214 Lidocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
L5647 Lidocaine hydrochloride monohydrate solid human pricing
L-018 Lidocaine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1385007 Mephenytoin United States Pharmacopeia (USP) Reference Standard human pricing
1387002 Mepivacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1955 Mepivacaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M0370000 Mepivacaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
M3189 Mepivacaine hydrochloride 98.0-102.0%, meets USP testing specifications human pricing
BP699 Mepivacaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
M2727 Mexiletine hydrochloride powder human pricing
1443250 Mexiletine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1860000 Mexiletine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001181 Orphenadrine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
75517 Orphenadrine hydrochloride ≥98.0% (AT) human pricing
Y0000100 Orphenadrine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1635 Oxcarbazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
19532 Oxcarbazepine analytical standard human pricing
1483152 Oxcarbazepine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001576 Oxcarbazepine European Pharmacopoeia (EP) Reference Standard human pricing
O-025 Oxcarbazepine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O0270000 Oxybuprocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP700 Oxybuprocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
34076 Phenazopyridine hydrochloride VETRANAL®, analytical standard human pricing
1515000 Phenazopyridine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1139 Phenytoin Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535008 Phenytoin United States Pharmacopeia (USP) Reference Standard human pricing
P1290000 Phenytoin European Pharmacopoeia (EP) Reference Standard human pricing
Y0001167 Phenytoin for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1492 Phenytoin sodium Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535507 Phenytoin sodium United States Pharmacopeia (USP) Reference Standard human pricing
P1300000 Phenytoin sodium European Pharmacopoeia (EP) Reference Standard human pricing
BP1238 Phenytoin sodium British Pharmacopoeia (BP) Reference Standard human pricing
P-063 Phenytoin solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001681 Prilocaine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P9547 Prilocaine hydrochloride ≥98% (TLC) human pricing
P3347 Prilocaine hydrochloride meets USP testing specifications human pricing
1561008 Prilocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P2939060 Prilocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP497 Prilocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1252 Procainamide hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1563502 Procainamide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML2088 Procainamide hydrochloride ≥98% (HPLC) human pricing
P3050000 Procainamide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P9391 Procainamide hydrochloride human pricing
81664 Procainamide hydrochloride purum, ≥98.0% (AT) human pricing
P9879 Procaine hydrochloride ≥97% human pricing
1564006 Procaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1161 Procaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
46608 Procaine hydrochloride VETRANAL®, analytical standard human pricing
P3100000 Procaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1571001 Proparacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P4554 Proparacaine hydrochloride analytical standard human pricing
1595000 Quinidine gluconate United States Pharmacopeia (USP) Reference Standard human pricing
Q5001 Quinidine gluconate salt analytical standard human pricing
Q0750 Quinidine hydrochloride monohydrate technical grade human pricing
1604337 Riluzole United States Pharmacopeia (USP) Reference Standard human pricing
R8404 Rufinamide ≥98% (HPLC), powder human pricing
PHR1625 Rufinamide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1606401 Rufinamide United States Pharmacopeia (USP) Reference Standard human pricing
T7383 Tetracaine ≥98% (TLC) human pricing
1649991 Tetracaine United States Pharmacopeia (USP) Reference Standard human pricing
T3812 Tetracaine meets USP testing specifications human pricing
Y0002117 Tetracaine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001002 Tetracaine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T7508 Tetracaine hydrochloride ≥99% human pricing
PHR1129 Tetracaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1650006 Tetracaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T0500000 Tetracaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T3937 Tetracaine hydrochloride meets USP testing specifications human pricing
T7645 Tetracaine hydrochloride Sigma Reference Standard human pricing
T0202 Tocainide hydrochloride ≥98% (HPLC), solid human pricing
1667552 Tocainide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Z2001 Zonisamide sodium salt ≥98% (HPLC), powder human pricing
Z-005 Zonisamide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
D4007 5,5-Diphenylhydantoin ≥98% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
B5435 BIA 2-093 ≥98% (HPLC), solid human, rat pricing
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing
L7757 Lidocaine powder human, rat pricing
L1026 Lidocaine analytical standard human, rat pricing
O3764 Oxcarbazepine ≥98% (HPLC), solid human, rat pricing
R116 Riluzole solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014191 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU187341 MISSION® esiRNA esiRNA targeting mouse Scn8a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014191 Rosetta Predictions human pricing
NM_019266 Rosetta Predictions rat pricing
NM_001077499 Rosetta Predictions mouse pricing
NM_011323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181322 predicted 4039
2 SASI_Hs01_00181323 predicted 429
3 SASI_Hs01_00181325 predicted 3161
4 SASI_Hs01_00181327 predicted 3441
5 SASI_Hs01_00181329 predicted 419
6 SASI_Hs02_00345222 predicted 2267
7 SASI_Hs02_00345223 predicted 5411
8 SASI_Hs01_00181328 predicted 5645
9 SASI_Hs02_00345224 predicted 4382
10 SASI_Hs01_00181330 predicted 1024
11 SASI_Hs01_00181321 predicted 1024
12 SASI_Hs01_00181324 predicted 4475
13 SASI_Hs01_00181326 predicted 4458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096593 predicted 419
2 SASI_Rn01_00096594 predicted 4032
3 SASI_Rn01_00096595 predicted 1017
4 SASI_Rn01_00096596 predicted 4952
5 SASI_Rn01_00096597 predicted 873
6 SASI_Rn01_00096598 predicted 5801
7 SASI_Rn01_00096599 predicted 2446
8 SASI_Rn01_00096601 predicted 1256
9 SASI_Rn02_00262159 predicted 4997
10 SASI_Rn02_00262160 predicted 3556
11 SASI_Rn01_00096600 predicted 4452
12 SASI_Rn01_00096602 predicted 5803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292702 predicted 4395
2 SASI_Mm02_00292703 predicted 3974
3 SASI_Mm02_00292704 predicted 4773
4 SASI_Mm02_00292705 predicted 4159
5 SASI_Mm02_00292706 predicted 2957
6 SASI_Mm02_00292707 predicted 4904
7 SASI_Mm02_00292708 predicted 2274
8 SASI_Mm02_00292709 predicted 3096
9 SASI_Mm02_00292710 predicted 1244
10 SASI_Mm02_00292711 predicted 3201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146812 predicted 4335
2 SASI_Mm01_00146813 predicted 3915
3 SASI_Mm01_00146814 predicted 4714
4 SASI_Mm01_00146816 predicted 4103
5 SASI_Mm01_00146817 predicted 2897
6 SASI_Mm01_00146818 predicted 4843
7 SASI_Mm01_00146819 predicted 2214
8 SASI_Mm01_00146820 predicted 3036
9 SASI_Mm02_00320413 predicted 1190
10 SASI_Mm02_00320414 predicted 3145
11 SASI_Mm01_00146815 predicted 852
12 SASI_Mm01_00146821 predicted 2248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011323
VALIDATED
SCN8A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage gated, type VIII, alpha subunit
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-3874s21c1
Sequence:CCGGTTAGTCAGCCTTATAGCTAATCTCGAGATTAGCTATAAGGCTGACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-299s21c1
Sequence:CCGGAGGACTTTGACCCGTACTATTCTCGAGAATAGTACGGGTCAAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-2336s21c1
Sequence:CCGGTTGTCCTGAACACACTATTTACTCGAGTAAATAGTGTGTTCAGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011323.2-6360s21c1
Sequence:CCGGGAAGCAGAAAGCATCACTTTACTCGAGTAAAGTGATGCTTTCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-4155s1c1
Sequence:CCGGCCGATGGAAGAACGTCAAGATCTCGAGATCTTGACGTTCTTCCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-256s1c1
Sequence:CCGGCCGTACTATTTGACGCAGAAACTCGAGTTTCTGCGTCAAATAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-4911s1c1
Sequence:CCGGCCTGCTCTTTGCCTTAATGATCTCGAGATCATTAAGGCAAAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011323.1-2159s1c1
Sequence:CCGGGCTGGTATAAGTTTGCCAATACTCGAGTATTGGCAAACTTATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-3076s1c1
Sequence:CCGGGCTGATGAAGTGAAACCTTTACTCGAGTAAAGGTTTCACTTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-951s21c1
Sequence:CCGGCTTCGACTGGGAGGAGTATATCTCGAGATATACTCCTCCCAGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011323.2-6237s21c1
Sequence:CCGGCACTCGGTCAATGCAACTTAGCTCGAGCTAAGTTGCATTGACCGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-2307s21c1
Sequence:CCGGTTTCGTAGACTTAGCCATAACCTCGAGGTTATGGCTAAGTCTACGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-4770s21c1
Sequence:CCGGTGCCTTGAGACACTACTATTTCTCGAGAAATAGTAGTGTCTCAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011323
VALIDATED
SCN8A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage gated, type VIII, alpha subunit
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-3874s21c1
Sequence:CCGGTTAGTCAGCCTTATAGCTAATCTCGAGATTAGCTATAAGGCTGACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-299s21c1
Sequence:CCGGAGGACTTTGACCCGTACTATTCTCGAGAATAGTACGGGTCAAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-2336s21c1
Sequence:CCGGTTGTCCTGAACACACTATTTACTCGAGTAAATAGTGTGTTCAGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011323.2-6360s21c1
Sequence:CCGGGAAGCAGAAAGCATCACTTTACTCGAGTAAAGTGATGCTTTCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-4155s1c1
Sequence:CCGGCCGATGGAAGAACGTCAAGATCTCGAGATCTTGACGTTCTTCCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-256s1c1
Sequence:CCGGCCGTACTATTTGACGCAGAAACTCGAGTTTCTGCGTCAAATAGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-4911s1c1
Sequence:CCGGCCTGCTCTTTGCCTTAATGATCTCGAGATCATTAAGGCAAAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011323.1-2159s1c1
Sequence:CCGGGCTGGTATAAGTTTGCCAATACTCGAGTATTGGCAAACTTATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-3076s1c1
Sequence:CCGGGCTGATGAAGTGAAACCTTTACTCGAGTAAAGGTTTCACTTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-951s21c1
Sequence:CCGGCTTCGACTGGGAGGAGTATATCTCGAGATATACTCCTCCCAGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011323.2-6237s21c1
Sequence:CCGGCACTCGGTCAATGCAACTTAGCTCGAGCTAAGTTGCATTGACCGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-2307s21c1
Sequence:CCGGTTTCGTAGACTTAGCCATAACCTCGAGGTTATGGCTAAGTCTACGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-4770s21c1
Sequence:CCGGTGCCTTGAGACACTACTATTTCTCGAGAAATAGTAGTGTCTCAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011323
VALIDATED
SCN8A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage gated, type VIII, alpha subunit
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-3874s21c1
Sequence:CCGGTTAGTCAGCCTTATAGCTAATCTCGAGATTAGCTATAAGGCTGACTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-299s21c1
Sequence:CCGGAGGACTTTGACCCGTACTATTCTCGAGAATAGTACGGGTCAAAGTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-2336s21c1
Sequence:CCGGTTGTCCTGAACACACTATTTACTCGAGTAAATAGTGTGTTCAGGACAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011323.2-6360s21c1
Sequence:CCGGGAAGCAGAAAGCATCACTTTACTCGAGTAAAGTGATGCTTTCTGCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-4155s1c1
Sequence:CCGGCCGATGGAAGAACGTCAAGATCTCGAGATCTTGACGTTCTTCCATCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-256s1c1
Sequence:CCGGCCGTACTATTTGACGCAGAAACTCGAGTTTCTGCGTCAAATAGTACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-4911s1c1
Sequence:CCGGCCTGCTCTTTGCCTTAATGATCTCGAGATCATTAAGGCAAAGAGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011323.1-2159s1c1
Sequence:CCGGGCTGGTATAAGTTTGCCAATACTCGAGTATTGGCAAACTTATACCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011323.1-3076s1c1
Sequence:CCGGGCTGATGAAGTGAAACCTTTACTCGAGTAAAGGTTTCACTTCATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-951s21c1
Sequence:CCGGCTTCGACTGGGAGGAGTATATCTCGAGATATACTCCTCCCAGTCGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011323.2-6237s21c1
Sequence:CCGGCACTCGGTCAATGCAACTTAGCTCGAGCTAAGTTGCATTGACCGAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-2307s21c1
Sequence:CCGGTTTCGTAGACTTAGCCATAACCTCGAGGTTATGGCTAAGTCTACGAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011323.2-4770s21c1
Sequence:CCGGTGCCTTGAGACACTACTATTTCTCGAGAAATAGTAGTGTCTCAAGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014191
SCN8A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage gated, type VIII, alpha subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-433s1c1
Sequence:CCGGCCCATACTATTTGACGCAGAACTCGAGTTCTGCGTCAAATAGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-4981s1c1
Sequence:CCGGCCTGGCAGATATAATTGAGAACTCGAGTTCTCAATTATATCTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-207s1c1
Sequence:CCGGGCCCTGATAGTTTCAAGCCTTCTCGAGAAGGCTTGAAACTATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-2500s1c1
Sequence:CCGGCCATCCTATGACACCACAATTCTCGAGAATTGTGGTGTCATAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-4468s1c1
Sequence:CCGGGCAGCCTAAGTATGAGGACAACTCGAGTTGTCCTCATACTTAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014191.2-2814s21c1
Sequence:CCGGCACTGGTGCTGGCCATTATTGCTCGAGCAATAATGGCCAGCACCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014191.2-6220s21c1
Sequence:CCGGACTCTAACCTGAAGATCTATACTCGAGTATAGATCTTCAGGTTAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014191.2-1477s21c1
Sequence:CCGGAGCAATGTTGGAGCAACTTAACTCGAGTTAAGTTGCTCCAACATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014191
SCN8A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage gated, type VIII, alpha subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-433s1c1
Sequence:CCGGCCCATACTATTTGACGCAGAACTCGAGTTCTGCGTCAAATAGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-4981s1c1
Sequence:CCGGCCTGGCAGATATAATTGAGAACTCGAGTTCTCAATTATATCTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-207s1c1
Sequence:CCGGGCCCTGATAGTTTCAAGCCTTCTCGAGAAGGCTTGAAACTATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-2500s1c1
Sequence:CCGGCCATCCTATGACACCACAATTCTCGAGAATTGTGGTGTCATAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-4468s1c1
Sequence:CCGGGCAGCCTAAGTATGAGGACAACTCGAGTTGTCCTCATACTTAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014191.2-2814s21c1
Sequence:CCGGCACTGGTGCTGGCCATTATTGCTCGAGCAATAATGGCCAGCACCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014191.2-6220s21c1
Sequence:CCGGACTCTAACCTGAAGATCTATACTCGAGTATAGATCTTCAGGTTAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014191.2-1477s21c1
Sequence:CCGGAGCAATGTTGGAGCAACTTAACTCGAGTTAAGTTGCTCCAACATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014191
SCN8A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage gated, type VIII, alpha subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-433s1c1
Sequence:CCGGCCCATACTATTTGACGCAGAACTCGAGTTCTGCGTCAAATAGTATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-4981s1c1
Sequence:CCGGCCTGGCAGATATAATTGAGAACTCGAGTTCTCAATTATATCTGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-207s1c1
Sequence:CCGGGCCCTGATAGTTTCAAGCCTTCTCGAGAAGGCTTGAAACTATCAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-2500s1c1
Sequence:CCGGCCATCCTATGACACCACAATTCTCGAGAATTGTGGTGTCATAGGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014191.1-4468s1c1
Sequence:CCGGGCAGCCTAAGTATGAGGACAACTCGAGTTGTCCTCATACTTAGGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000436809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014191.2-2814s21c1
Sequence:CCGGCACTGGTGCTGGCCATTATTGCTCGAGCAATAATGGCCAGCACCAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014191.2-6220s21c1
Sequence:CCGGACTCTAACCTGAAGATCTATACTCGAGTATAGATCTTCAGGTTAGAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014191.2-1477s21c1
Sequence:CCGGAGCAATGTTGGAGCAACTTAACTCGAGTTAAGTTGCTCCAACATTGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???