EMAIL THIS PAGE TO A FRIEND

SCN9A

sodium channel, voltage-gated, type IX, alpha subunit

284 Gene Product Result for
Synonyms: ETHA FEB3B GEFSP7 NE-NA NENA Nav1.7 PN1 SFNP
Gene ID:
Human(6335) Summary: This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
Mouse(20274) sodium channel, voltage-gated, type IX, alpha
Rat(78956) sodium channel, voltage-gated, type IX, alpha
chicken(395946) sodium channel, voltage-gated, type IX, alpha subunit
domestic cat(101082841) sodium channel, voltage-gated, type IX, alpha subunit
dog(488381) sodium channel, voltage-gated, type IX, alpha subunit
Horse(100052120) sodium channel, voltage-gated, type IX, alpha subunit
cow(533065) sodium channel, voltage-gated, type IX, alpha subunit
sheep(101122924) sodium channel, voltage-gated, type IX, alpha subunit
naked mole-rat(101710863) sodium channel, voltage-gated, type IX, alpha subunit
Domestic Rabbit(100009210) sodium channel, voltage-gated, type IX, alpha subunit
domestic guinea pig(100714438) sodium channel, voltage-gated, type IX, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
UC177 (±)-Mephenytoin human pricing
SML1444 (±)-Mepivacaine hydrochloride ≥98% (HPLC) human pricing
PHL80964 (+)-Quinidine phyproof® Reference Substance human pricing
462047 1-(2,6-Dimethylphenoxy)-2-propanamine hydrochloride 97% human pricing
146668 2,4-Dichlorobenzyl alcohol 99% human pricing
Y0001620 2,4-Dichlorobenzyl alcohol European Pharmacopoeia (EP) Reference Standard human pricing
CDS021586 2-(Diethylamino)ethyl 4-amino-2-propoxybenzoate human pricing
D6658 5,5-Diphenylhydantoin solution drug standard, 1.0 mg/mL in methanol human pricing
1042918 Articaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML1093 Articaine hydrochloride ≥98% (HPLC) human pricing
Y0000079 Articaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1881 Articaine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B9050 Benoxinate hydrochloride meets USP testing specifications human pricing
1050009 Benoxinate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
B4386 Benoxinate hydrochloride ≥98% human pricing
94496 Carbamazepine analytical standard human pricing
PHR1067 Carbamazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1093001 Carbamazepine United States Pharmacopeia (USP) Reference Standard human pricing
C0450000 Carbamazepine European Pharmacopoeia (EP) Reference Standard human pricing
BP974 Carbamazepine British Pharmacopoeia (BP) Reference Standard human pricing
C-053 Carbamazepine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
D2920000 Disopyramide European Pharmacopoeia (EP) Reference Standard human pricing
D7275 Disopyramide human pricing
1222501 Disopyramide phosphate United States Pharmacopeia (USP) Reference Standard human pricing
D2922000 Disopyramide phosphate European Pharmacopoeia (EP) Reference Standard human pricing
D6035 Disopyramide phosphate salt human pricing
D9696 Dronedarone hydrochloride ≥98% (HPLC) human pricing
1228530 Dronedarone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0002121 Dronedarone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1230000 Dyclonine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1849 Dyclonine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
E9156 Encainide hydrochloride ≥98% (HPLC), powder human pricing
L-029 Lacosamide solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1392 Lamotrigine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1356756 Lamotrigine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001030 Lamotrigine European Pharmacopoeia (EP) Reference Standard human pricing
BP1097 Lamotrigine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001031 Lamotrigine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001085 Lamotrigine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-019 Lamotrigine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1034 Lidocaine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366002 Lidocaine United States Pharmacopeia (USP) Reference Standard human pricing
L0595000 Lidocaine European Pharmacopoeia (EP) Reference Standard human pricing
BP727 Lidocaine British Pharmacopoeia (BP) Reference Standard human pricing
PHR1257 Lidocaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1366013 Lidocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0600000 Lidocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP214 Lidocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
L5647 Lidocaine hydrochloride monohydrate solid human pricing
L-018 Lidocaine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1385007 Mephenytoin United States Pharmacopeia (USP) Reference Standard human pricing
1387002 Mepivacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1955 Mepivacaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M0370000 Mepivacaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
M3189 Mepivacaine hydrochloride 98.0-102.0%, meets USP testing specifications human pricing
BP699 Mepivacaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
M2727 Mexiletine hydrochloride powder human pricing
1443250 Mexiletine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1860000 Mexiletine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001181 Orphenadrine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
75517 Orphenadrine hydrochloride ≥98.0% (AT) human pricing
Y0000100 Orphenadrine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1635 Oxcarbazepine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
19532 Oxcarbazepine analytical standard human pricing
1483152 Oxcarbazepine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001576 Oxcarbazepine European Pharmacopoeia (EP) Reference Standard human pricing
O-025 Oxcarbazepine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O0270000 Oxybuprocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP700 Oxybuprocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
34076 Phenazopyridine hydrochloride VETRANAL®, analytical standard human pricing
1515000 Phenazopyridine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1139 Phenytoin Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535008 Phenytoin United States Pharmacopeia (USP) Reference Standard human pricing
P1290000 Phenytoin European Pharmacopoeia (EP) Reference Standard human pricing
Y0001167 Phenytoin for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1492 Phenytoin sodium Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1535507 Phenytoin sodium United States Pharmacopeia (USP) Reference Standard human pricing
P1300000 Phenytoin sodium European Pharmacopoeia (EP) Reference Standard human pricing
BP1238 Phenytoin sodium British Pharmacopoeia (BP) Reference Standard human pricing
P-063 Phenytoin solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001681 Prilocaine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P9547 Prilocaine hydrochloride ≥98% (TLC) human pricing
P3347 Prilocaine hydrochloride meets USP testing specifications human pricing
1561008 Prilocaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P2939060 Prilocaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP497 Prilocaine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1252 Procainamide hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1563502 Procainamide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
SML2088 Procainamide hydrochloride ≥98% (HPLC) human pricing
P3050000 Procainamide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P9391 Procainamide hydrochloride human pricing
81664 Procainamide hydrochloride purum, ≥98.0% (AT) human pricing
P9879 Procaine hydrochloride ≥97% human pricing
1564006 Procaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1161 Procaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
46608 Procaine hydrochloride VETRANAL®, analytical standard human pricing
P3100000 Procaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1571001 Proparacaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P4554 Proparacaine hydrochloride analytical standard human pricing
1595000 Quinidine gluconate United States Pharmacopeia (USP) Reference Standard human pricing
Q5001 Quinidine gluconate salt analytical standard human pricing
Q0750 Quinidine hydrochloride monohydrate technical grade human pricing
1604337 Riluzole United States Pharmacopeia (USP) Reference Standard human pricing
R8404 Rufinamide ≥98% (HPLC), powder human pricing
PHR1625 Rufinamide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1606401 Rufinamide United States Pharmacopeia (USP) Reference Standard human pricing
T7383 Tetracaine ≥98% (TLC) human pricing
1649991 Tetracaine United States Pharmacopeia (USP) Reference Standard human pricing
T3812 Tetracaine meets USP testing specifications human pricing
Y0002117 Tetracaine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001002 Tetracaine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T7508 Tetracaine hydrochloride ≥99% human pricing
PHR1129 Tetracaine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1650006 Tetracaine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T0500000 Tetracaine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T3937 Tetracaine hydrochloride meets USP testing specifications human pricing
T7645 Tetracaine hydrochloride Sigma Reference Standard human pricing
T0202 Tocainide hydrochloride ≥98% (HPLC), solid human pricing
1667552 Tocainide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Z2001 Zonisamide sodium salt ≥98% (HPLC), powder human pricing
Z-005 Zonisamide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D4007 5,5-Diphenylhydantoin ≥98% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
B5435 BIA 2-093 ≥98% (HPLC), solid human, rat pricing
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
L3791 Lamotrigine ≥98%, powder human, rat pricing
L7757 Lidocaine powder human, rat pricing
L1026 Lidocaine analytical standard human, rat pricing
O3764 Oxcarbazepine ≥98% (HPLC), solid human, rat pricing
R116 Riluzole solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_196271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_196271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_196271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002977 Rosetta Predictions human pricing
NM_133289 Rosetta Predictions rat pricing
NM_018852 Rosetta Predictions mouse pricing
XM_196271 Rosetta Predictions mouse pricing
XM_899657 Rosetta Predictions mouse pricing
XM_899666 Rosetta Predictions mouse pricing
XM_899671 Rosetta Predictions mouse pricing
XM_899677 Rosetta Predictions mouse pricing
XM_899685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056753 predicted 5714
2 SASI_Hs01_00056755 predicted 4588
3 SASI_Hs01_00056756 predicted 3983
4 SASI_Hs01_00056757 predicted 3565
5 SASI_Hs02_00334850 predicted 2970
6 SASI_Hs01_00056758 predicted 999
7 SASI_Hs01_00056759 predicted 3862
8 SASI_Hs01_00056760 predicted 5708
9 SASI_Hs01_00056761 predicted 4071
10 SASI_Hs01_00056762 predicted 1173
11 SASI_Hs01_00056754 predicted 4136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078243 predicted 5549
2 SASI_Rn02_00267572 predicted 2401
3 SASI_Rn01_00078244 predicted 3175
4 SASI_Rn02_00267573 predicted 3780
5 SASI_Rn01_00078246 predicted 2239
6 SASI_Rn01_00078247 predicted 373
7 SASI_Rn01_00078249 predicted 3878
8 SASI_Rn01_00078250 predicted 3845
9 SASI_Rn01_00078251 predicted 1969
10 SASI_Rn02_00267574 predicted 5805
11 SASI_Rn01_00078245 predicted 2440
12 SASI_Rn01_00078248 predicted 1937
13 SASI_Rn01_00078252 predicted 2831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324199 predicted 6286
2 SASI_Mm02_00324200 predicted 4754
3 SASI_Mm02_00324201 predicted 4308
4 SASI_Mm02_00324202 predicted 2758
5 SASI_Mm02_00324203 predicted 4360
6 SASI_Mm02_00324204 predicted 6463
7 SASI_Mm02_00324205 predicted 4400
8 SASI_Mm02_00324206 predicted 2488
9 SASI_Mm02_00324207 predicted 4672
10 SASI_Mm02_00324208 predicted 4516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_196271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279736 predicted 6324
2 SASI_Mm01_00279737 predicted 6205
3 SASI_Mm01_00279738 predicted 6210
4 SASI_Mm01_00279739 predicted 6308
5 SASI_Mm01_00279740 predicted 6306
6 SASI_Mm01_00279741 predicted 6320
7 SASI_Mm01_00279742 predicted 6384
8 SASI_Mm01_00279743 predicted 6214
9 SASI_Mm01_00279744 predicted 6270
10 SASI_Mm01_00279745 predicted 6314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239699 predicted 6354
2 SASI_Mm01_00239700 predicted 6232
3 SASI_Mm01_00239701 predicted 6240
4 SASI_Mm01_00239702 predicted 6338
5 SASI_Mm01_00239703 predicted 6336
6 SASI_Mm01_00239704 predicted 6348
7 SASI_Mm01_00239705 predicted 6414
8 SASI_Mm01_00239706 predicted 6241
9 SASI_Mm01_00239707 predicted 6291
10 SASI_Mm01_00239708 predicted 6338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258739 predicted 6356
2 SASI_Mm01_00258740 predicted 6241
3 SASI_Mm01_00258741 predicted 6235
4 SASI_Mm01_00258742 predicted 6334
5 SASI_Mm01_00258743 predicted 6338
6 SASI_Mm01_00258744 predicted 6353
7 SASI_Mm01_00258745 predicted 6414
8 SASI_Mm01_00258746 predicted 6235
9 SASI_Mm01_00258747 predicted 6292
10 SASI_Mm01_00258748 predicted 6341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218878 predicted 6300
2 SASI_Mm01_00218879 predicted 6184
3 SASI_Mm01_00218880 predicted 6183
4 SASI_Mm01_00218881 predicted 6281
5 SASI_Mm01_00218882 predicted 6288
6 SASI_Mm01_00218883 predicted 6290
7 SASI_Mm01_00218884 predicted 6355
8 SASI_Mm01_00218885 predicted 6186
9 SASI_Mm01_00218886 predicted 6234
10 SASI_Mm01_00218887 predicted 6282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201964 predicted 6320
2 SASI_Mm01_00201965 predicted 6201
3 SASI_Mm01_00201966 predicted 6210
4 SASI_Mm01_00201967 predicted 6310
5 SASI_Mm01_00201968 predicted 6306
6 SASI_Mm01_00201969 predicted 6323
7 SASI_Mm01_00201970 predicted 6376
8 SASI_Mm01_00201971 predicted 6214
9 SASI_Mm01_00201972 predicted 6267
10 SASI_Mm01_00201973 predicted 6313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241869 predicted 6285
2 SASI_Mm01_00241870 predicted 6171
3 SASI_Mm01_00241871 predicted 6172
4 SASI_Mm01_00241872 predicted 6272
5 SASI_Mm01_00241873 predicted 6280
6 SASI_Mm01_00241874 predicted 6292
7 SASI_Mm01_00241875 predicted 6349
8 SASI_Mm01_00241876 predicted 6175
9 SASI_Mm01_00241877 predicted 6237
10 SASI_Mm01_00241878 predicted 6276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002977
SCN9A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type IX, alpha subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-5164s21c1
Sequence:CCGGGAATCCTACGTCTAGTCAAAGCTCGAGCTTTGACTAGACGTAGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-4234s21c1
Sequence:CCGGTCGTTGTGAATGCACTCATAGCTCGAGCTATGAGTGCATTCACAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-4522s21c1
Sequence:CCGGTTAAGGGATGGACGATTATTACTCGAGTAATAATCGTCCATCCCTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-109s1c1
Sequence:CCGGGCCCTCATTGAACAACGCATTCTCGAGAATGCGTTGTTCAATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-4801s1c1
Sequence:CCGGGCTGATTTGATTGAAACGTATCTCGAGATACGTTTCAATCAAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-4130s1c1
Sequence:CCGGCCCTTATGAATGTTAGTCAAACTCGAGTTTGACTAACATTCATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-1379s1c1
Sequence:CCGGCGGCTGAATATACAAGTATTACTCGAGTAATACTTGTATATTCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-5629s1c1
Sequence:CCGGCCTTCCAAAGTGTCCTATGAACTCGAGTTCATAGGACACTTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002977
SCN9A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type IX, alpha subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-5164s21c1
Sequence:CCGGGAATCCTACGTCTAGTCAAAGCTCGAGCTTTGACTAGACGTAGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-4234s21c1
Sequence:CCGGTCGTTGTGAATGCACTCATAGCTCGAGCTATGAGTGCATTCACAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-4522s21c1
Sequence:CCGGTTAAGGGATGGACGATTATTACTCGAGTAATAATCGTCCATCCCTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-109s1c1
Sequence:CCGGGCCCTCATTGAACAACGCATTCTCGAGAATGCGTTGTTCAATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-4801s1c1
Sequence:CCGGGCTGATTTGATTGAAACGTATCTCGAGATACGTTTCAATCAAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-4130s1c1
Sequence:CCGGCCCTTATGAATGTTAGTCAAACTCGAGTTTGACTAACATTCATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-1379s1c1
Sequence:CCGGCGGCTGAATATACAAGTATTACTCGAGTAATACTTGTATATTCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-5629s1c1
Sequence:CCGGCCTTCCAAAGTGTCCTATGAACTCGAGTTCATAGGACACTTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002977
SCN9A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type IX, alpha subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-5164s21c1
Sequence:CCGGGAATCCTACGTCTAGTCAAAGCTCGAGCTTTGACTAGACGTAGGATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-4234s21c1
Sequence:CCGGTCGTTGTGAATGCACTCATAGCTCGAGCTATGAGTGCATTCACAACGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002977.3-4522s21c1
Sequence:CCGGTTAAGGGATGGACGATTATTACTCGAGTAATAATCGTCCATCCCTTAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-109s1c1
Sequence:CCGGGCCCTCATTGAACAACGCATTCTCGAGAATGCGTTGTTCAATGAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-4801s1c1
Sequence:CCGGGCTGATTTGATTGAAACGTATCTCGAGATACGTTTCAATCAAATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-4130s1c1
Sequence:CCGGCCCTTATGAATGTTAGTCAAACTCGAGTTTGACTAACATTCATAAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-1379s1c1
Sequence:CCGGCGGCTGAATATACAAGTATTACTCGAGTAATACTTGTATATTCAGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002977.1-5629s1c1
Sequence:CCGGCCTTCCAAAGTGTCCTATGAACTCGAGTTCATAGGACACTTTGGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018852
SCN9A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type IX, alpha subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-372s1c1
Sequence:CCGGCCAGTTCATAGAGTTCTGCAACTCGAGTTGCAGAACTCTATGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-565s1c1
Sequence:CCGGCTTCGTTCACAGATGGAAGAACTCGAGTTCTTCCATCTGTGAACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-757s1c1
Sequence:CCGGGATGACGATTTGCCCAATAAACTCGAGTTTATTGGGCAAATCGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-930s1c1
Sequence:CCGGGAAAGACGAAAGCAGGAAATACTCGAGTATTTCCTGCTTTCGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-583s1c1
Sequence:CCGGGAAAGGTTTATGTCAGCCAATCTCGAGATTGGCTGACATAAACCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.2-5020s1c1
Sequence:CCGGCAAATTCCAAGGATGCATATTCTCGAGAATATGCATCCTTGGAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-6651s1c1
Sequence:CCGGGCGTTGGTCAATGATTCTTTACTCGAGTAAAGAATCATTGACCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-8135s1c1
Sequence:CCGGCTTCATCAATTTGCCTATAAACTCGAGTTTATAGGCAAATTGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-6512s1c1
Sequence:CCGGGGTGACTCACTCGTGTTAATACTCGAGTATTAACACGAGTGAGTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-763s1c1
Sequence:CCGGGATTTGCCCAATAAAGAAGATCTCGAGATCTTCTTTATTGGGCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018852
SCN9A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type IX, alpha subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-372s1c1
Sequence:CCGGCCAGTTCATAGAGTTCTGCAACTCGAGTTGCAGAACTCTATGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-565s1c1
Sequence:CCGGCTTCGTTCACAGATGGAAGAACTCGAGTTCTTCCATCTGTGAACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-757s1c1
Sequence:CCGGGATGACGATTTGCCCAATAAACTCGAGTTTATTGGGCAAATCGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-930s1c1
Sequence:CCGGGAAAGACGAAAGCAGGAAATACTCGAGTATTTCCTGCTTTCGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-583s1c1
Sequence:CCGGGAAAGGTTTATGTCAGCCAATCTCGAGATTGGCTGACATAAACCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.2-5020s1c1
Sequence:CCGGCAAATTCCAAGGATGCATATTCTCGAGAATATGCATCCTTGGAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-6651s1c1
Sequence:CCGGGCGTTGGTCAATGATTCTTTACTCGAGTAAAGAATCATTGACCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-8135s1c1
Sequence:CCGGCTTCATCAATTTGCCTATAAACTCGAGTTTATAGGCAAATTGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-6512s1c1
Sequence:CCGGGGTGACTCACTCGTGTTAATACTCGAGTATTAACACGAGTGAGTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-763s1c1
Sequence:CCGGGATTTGCCCAATAAAGAAGATCTCGAGATCTTCTTTATTGGGCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018852
SCN9A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type IX, alpha subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-372s1c1
Sequence:CCGGCCAGTTCATAGAGTTCTGCAACTCGAGTTGCAGAACTCTATGAACTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000173720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-565s1c1
Sequence:CCGGCTTCGTTCACAGATGGAAGAACTCGAGTTCTTCCATCTGTGAACGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-757s1c1
Sequence:CCGGGATGACGATTTGCCCAATAAACTCGAGTTTATTGGGCAAATCGTCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-930s1c1
Sequence:CCGGGAAAGACGAAAGCAGGAAATACTCGAGTATTTCCTGCTTTCGTCTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000194178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-583s1c1
Sequence:CCGGGAAAGGTTTATGTCAGCCAATCTCGAGATTGGCTGACATAAACCTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.2-5020s1c1
Sequence:CCGGCAAATTCCAAGGATGCATATTCTCGAGAATATGCATCCTTGGAATTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-6651s1c1
Sequence:CCGGGCGTTGGTCAATGATTCTTTACTCGAGTAAAGAATCATTGACCAACGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-8135s1c1
Sequence:CCGGCTTCATCAATTTGCCTATAAACTCGAGTTTATAGGCAAATTGATGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018852.2-6512s1c1
Sequence:CCGGGGTGACTCACTCGTGTTAATACTCGAGTATTAACACGAGTGAGTCACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018852.1-763s1c1
Sequence:CCGGGATTTGCCCAATAAAGAAGATCTCGAGATCTTCTTTATTGGGCAAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_196271
SCN9A MISSION shRNA Bacterial Glycerol Stock
sodium channel, voltage-gated, type IX, alpha subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-898s1c1
Sequence:CCGGGCTGCTGAGTACACGAGTTTACTCGAGTAAACTCGTGTACTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-1276s1c1
Sequence:CCGGGCTGATGATGAGCATAGCATTCTCGAGAATGCTATGCTCATCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-405s1c1
Sequence:CCGGCCTTGAGCAGAATGAAACATTCTCGAGAATGTTTCATTCTGCTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-799s1c1
Sequence:CCGGGCCAACATCGAAGAAGCTAAACTCGAGTTTAGCTTCTTCGATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-840s1c1
Sequence:CCGGGCAGATGTTAGACCGACTCAACTCGAGTTGAGTCGGTCTAACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_196271
SCN9A MISSION shRNA shRNA Plasmid DNA
sodium channel, voltage-gated, type IX, alpha subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-898s1c1
Sequence:CCGGGCTGCTGAGTACACGAGTTTACTCGAGTAAACTCGTGTACTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-1276s1c1
Sequence:CCGGGCTGATGATGAGCATAGCATTCTCGAGAATGCTATGCTCATCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-405s1c1
Sequence:CCGGCCTTGAGCAGAATGAAACATTCTCGAGAATGTTTCATTCTGCTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-799s1c1
Sequence:CCGGGCCAACATCGAAGAAGCTAAACTCGAGTTTAGCTTCTTCGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-840s1c1
Sequence:CCGGGCAGATGTTAGACCGACTCAACTCGAGTTGAGTCGGTCTAACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_196271
SCN9A MISSION shRNA Lentiviral Transduction Particles
sodium channel, voltage-gated, type IX, alpha subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-898s1c1
Sequence:CCGGGCTGCTGAGTACACGAGTTTACTCGAGTAAACTCGTGTACTCAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-1276s1c1
Sequence:CCGGGCTGATGATGAGCATAGCATTCTCGAGAATGCTATGCTCATCATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-405s1c1
Sequence:CCGGCCTTGAGCAGAATGAAACATTCTCGAGAATGTTTCATTCTGCTCAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-799s1c1
Sequence:CCGGGCCAACATCGAAGAAGCTAAACTCGAGTTTAGCTTCTTCGATGTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196271.2-840s1c1
Sequence:CCGGGCAGATGTTAGACCGACTCAACTCGAGTTGAGTCGGTCTAACATCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???