EMAIL THIS PAGE TO A FRIEND

SCNN1A

sodium channel, non-voltage-gated 1 alpha subunit

139 Gene Product Result for
Synonyms: BESC2 ENaCa ENaCalpha SCNEA SCNN1
Gene ID:
Human(6337) Summary: Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
Mouse(20276) sodium channel, nonvoltage-gated 1 alpha
Rat(25122) sodium channel, nonvoltage-gated 1 alpha
cow(282348) sodium channel, non-voltage-gated 1 alpha subunit
sheep(443488) sodium channel, non-voltage-gated 1 alpha subunit
naked mole-rat(101700410) sodium channel, non-voltage-gated 1 alpha subunit
domestic guinea pig(100135613) sodium channel, nonvoltage-gated 1 alpha
chicken(396050) sodium channel, non-voltage-gated 1 alpha subunit
domestic cat(101091122) sodium channel, non-voltage-gated 1 alpha subunit
dog(403650) sodium channel, non-voltage-gated 1 alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012743 Anti-SCNN1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA012939 Anti-SCNN1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5200105 Anti-SCNN1A antibody produced in rabbit 1 mg/mL, affinity isolated antibody rat, mouse
immunohistochemistry, western blot pricing
SAB5201770 Monoclonal Anti-ENaC alpha antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201824 Monoclonal Anti-ENaC alpha antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201779 Monoclonal Anti-ENaC alpha-Alkaline Phosphatase antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201833 Monoclonal Anti-ENaC alpha-Alkaline Phosphatase antibody produced in mouse clone 14E10 mouse, rat
immunohistochemistry, western blot pricing
SAB5201780 Monoclonal Anti-ENaC alpha-Allophycocyanin antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201834 Monoclonal Anti-ENaC alpha-Allophycocyanin antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201771 Monoclonal Anti-ENaC alpha-Atto 390 antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201825 Monoclonal Anti-ENaC alpha-Atto 390 antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201772 Monoclonal Anti-ENaC alpha-Atto 488 antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201826 Monoclonal Anti-ENaC alpha-Atto 488 antibody produced in mouse clone 14E10 mouse, rat
immunohistochemistry, western blot pricing
SAB5201774 Monoclonal Anti-ENaC alpha-Atto 594 antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201828 Monoclonal Anti-ENaC alpha-Atto 594 antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201773 Monoclonal Anti-ENaC alpha-Atto 595 antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201827 Monoclonal Anti-ENaC alpha-Atto 595 antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201775 Monoclonal Anti-ENaC alpha-Atto 633 antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201829 Monoclonal Anti-ENaC alpha-Atto 633 antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201776 Monoclonal Anti-ENaC alpha-Atto 655 antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201830 Monoclonal Anti-ENaC alpha-Atto 655 antibody produced in mouse clone 14E10 mouse, rat
immunohistochemistry, western blot pricing
SAB5201777 Monoclonal Anti-ENaC alpha-Atto 680 antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201831 Monoclonal Anti-ENaC alpha-Atto 680 antibody produced in mouse clone 14E10 mouse, rat
immunohistochemistry, western blot pricing
SAB5201778 Monoclonal Anti-ENaC alpha-Atto 700 antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201832 Monoclonal Anti-ENaC alpha-Atto 700 antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201781 Monoclonal Anti-ENaC alpha-Biotin antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201835 Monoclonal Anti-ENaC alpha-Biotin antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201782 Monoclonal Anti-ENaC alpha-FITC antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201836 Monoclonal Anti-ENaC alpha-FITC antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201783 Monoclonal Anti-ENaC alpha-Horseradish Peroxidase antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201837 Monoclonal Anti-ENaC alpha-Horseradish Peroxidase antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201784 Monoclonal Anti-ENaC alpha-PE/Atto 594 antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201838 Monoclonal Anti-ENaC alpha-PE/Atto 594 antibody produced in mouse clone 14E10 mouse, rat
immunohistochemistry, western blot pricing
SAB5201785 Monoclonal Anti-ENaC alpha-PerCP antibody produced in mouse clone 2G4 mouse, rat
immunohistochemistry, western blot pricing
SAB5201839 Monoclonal Anti-ENaC alpha-PerCP antibody produced in mouse clone 14E10 mouse, rat
immunohistochemistry, western blot pricing
SAB5201786 Monoclonal Anti-ENaC alpha-R-Phycoerythrin antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201840 Monoclonal Anti-ENaC alpha-R-Phycoerythrin antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing
SAB5201787 Monoclonal Anti-ENaC alpha-Streptavidin antibody produced in mouse clone 2G4 rat, mouse
immunohistochemistry, western blot pricing
SAB5201841 Monoclonal Anti-ENaC alpha-Streptavidin antibody produced in mouse clone 14E10 rat, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038 Rosetta Predictions human pricing
NM_031548 Rosetta Predictions rat pricing
NM_011324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152993 predicted 563
2 SASI_Hs01_00152994 predicted 1641
3 SASI_Hs01_00152995 predicted 1310
4 SASI_Hs01_00152996 predicted 997
5 SASI_Hs01_00152997 predicted 1142
6 SASI_Hs01_00152998 predicted 977
7 SASI_Hs01_00152999 predicted 1004
8 SASI_Hs01_00153000 predicted 1644
9 SASI_Hs01_00153001 predicted 1613
10 SASI_Hs01_00153002 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264731 predicted 1149
2 SASI_Rn01_00074166 predicted 2029
3 SASI_Rn01_00074167 predicted 1656
4 SASI_Rn01_00074168 predicted 1321
5 SASI_Rn01_00074169 predicted 2501
6 SASI_Rn01_00074170 predicted 433
7 SASI_Rn02_00264732 predicted 847
8 SASI_Rn01_00074172 predicted 1604
9 SASI_Rn01_00074174 predicted 1651
10 SASI_Rn02_00264733 predicted 1877
11 SASI_Rn01_00074171 predicted 1766
12 SASI_Rn01_00074173 predicted 787
13 SASI_Rn01_00074175 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187969 predicted 1692
2 SASI_Mm01_00187970 predicted 1845
3 SASI_Mm01_00187971 predicted 1401
4 SASI_Mm01_00187972 predicted 516
5 SASI_Mm01_00187973 predicted 1838
6 SASI_Mm01_00187974 predicted 514
7 SASI_Mm01_00187975 predicted 1435
8 SASI_Mm02_00320415 predicted 1808
9 SASI_Mm01_00187977 predicted 979
10 SASI_Mm01_00187978 predicted 1691
11 SASI_Mm01_00187976 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001038
VALIDATED
SCNN1A MISSION shRNA Bacterial Glycerol Stock
sodium channel, non-voltage-gated 1 alpha subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1150s21c1
Sequence:CCGGCTCCTGCAACCAGGCGAATTACTCGAGTAATTCGCCTGGTTGCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1188s21c1
Sequence:CCGGCGATGTATGGAAACTGCTATACTCGAGTATAGCAGTTTCCATACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038.5-2622s21c1
Sequence:CCGGTTCCTAAGAAACCGCTGATAACTCGAGTTATCAGCGGTTTCTTAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-998s1c1
Sequence:CCGGCGATGTATGGAAACTGCTATACTCGAGTATAGCAGTTTCCATACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1288s21c1
Sequence:CCGGCGCAGAGCAGAATGACTTCATCTCGAGATGAAGTCATTCTGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-789s1c1
Sequence:CCGGCCAGAACAAATCGGACTGCTTCTCGAGAAGCAGTCCGATTTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-519s1c1
Sequence:CCGGCCCGGAAATTAAAGAGGAGCTCTCGAGAGCTCCTCTTTAATTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-1098s1c1
Sequence:CCGGCGCAGAGCAGAATGACTTCATCTCGAGATGAAGTCATTCTGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1816s21c1
Sequence:CCGGGAACAATTACACCGTCAACAACTCGAGTTGTTGACGGTGTAATTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-1626s1c1
Sequence:CCGGGAACAATTACACCGTCAACAACTCGAGTTGTTGACGGTGTAATTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001038
VALIDATED
SCNN1A MISSION shRNA shRNA Plasmid DNA
sodium channel, non-voltage-gated 1 alpha subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1150s21c1
Sequence:CCGGCTCCTGCAACCAGGCGAATTACTCGAGTAATTCGCCTGGTTGCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1188s21c1
Sequence:CCGGCGATGTATGGAAACTGCTATACTCGAGTATAGCAGTTTCCATACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038.5-2622s21c1
Sequence:CCGGTTCCTAAGAAACCGCTGATAACTCGAGTTATCAGCGGTTTCTTAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-998s1c1
Sequence:CCGGCGATGTATGGAAACTGCTATACTCGAGTATAGCAGTTTCCATACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1288s21c1
Sequence:CCGGCGCAGAGCAGAATGACTTCATCTCGAGATGAAGTCATTCTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-789s1c1
Sequence:CCGGCCAGAACAAATCGGACTGCTTCTCGAGAAGCAGTCCGATTTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-519s1c1
Sequence:CCGGCCCGGAAATTAAAGAGGAGCTCTCGAGAGCTCCTCTTTAATTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-1098s1c1
Sequence:CCGGCGCAGAGCAGAATGACTTCATCTCGAGATGAAGTCATTCTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1816s21c1
Sequence:CCGGGAACAATTACACCGTCAACAACTCGAGTTGTTGACGGTGTAATTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-1626s1c1
Sequence:CCGGGAACAATTACACCGTCAACAACTCGAGTTGTTGACGGTGTAATTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001038
VALIDATED
SCNN1A MISSION shRNA Lentiviral Transduction Particles
sodium channel, non-voltage-gated 1 alpha subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1150s21c1
Sequence:CCGGCTCCTGCAACCAGGCGAATTACTCGAGTAATTCGCCTGGTTGCAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1188s21c1
Sequence:CCGGCGATGTATGGAAACTGCTATACTCGAGTATAGCAGTTTCCATACATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038.5-2622s21c1
Sequence:CCGGTTCCTAAGAAACCGCTGATAACTCGAGTTATCAGCGGTTTCTTAGGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-998s1c1
Sequence:CCGGCGATGTATGGAAACTGCTATACTCGAGTATAGCAGTTTCCATACATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1288s21c1
Sequence:CCGGCGCAGAGCAGAATGACTTCATCTCGAGATGAAGTCATTCTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-789s1c1
Sequence:CCGGCCAGAACAAATCGGACTGCTTCTCGAGAAGCAGTCCGATTTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-519s1c1
Sequence:CCGGCCCGGAAATTAAAGAGGAGCTCTCGAGAGCTCCTCTTTAATTTCCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-1098s1c1
Sequence:CCGGCGCAGAGCAGAATGACTTCATCTCGAGATGAAGTCATTCTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038.5-1816s21c1
Sequence:CCGGGAACAATTACACCGTCAACAACTCGAGTTGTTGACGGTGTAATTGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001038.3-1626s1c1
Sequence:CCGGGAACAATTACACCGTCAACAACTCGAGTTGTTGACGGTGTAATTGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011324
SCNN1A MISSION shRNA Bacterial Glycerol Stock
sodium channel, non-voltage-gated 1 alpha subunit
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011324.1-2827s1c1
Sequence:CCGGGCTGTATTAGATGCTCACATTCTCGAGAATGTGAGCATCTAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-1669s1c1
Sequence:CCGGCGGAGTTGCTAAACTCAACATCTCGAGATGTTGAGTTTAGCAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-974s1c1
Sequence:CCGGCCCTGCAATCAGGCGAATTATCTCGAGATAATTCGCCTGATTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-504s1c1
Sequence:CCGGGCACCCTTAATCCTTACAGATCTCGAGATCTGTAAGGATTAAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-1621s1c1
Sequence:CCGGCGAGATGCTATCCTTGCAGAACTCGAGTTCTGCAAGGATAGCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011324.2-925s21c1
Sequence:CCGCTGCTTTGCTGTTCGAGGAATACTCGAGTATTCCTCGAACAGCAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011324.2-615s21c1
Sequence:CCGGGATCCATGAAGGGCAACAATTCTCGAGAATTGTTGCCCTTCATGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011324
SCNN1A MISSION shRNA shRNA Plasmid DNA
sodium channel, non-voltage-gated 1 alpha subunit
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011324.1-2827s1c1
Sequence:CCGGGCTGTATTAGATGCTCACATTCTCGAGAATGTGAGCATCTAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-1669s1c1
Sequence:CCGGCGGAGTTGCTAAACTCAACATCTCGAGATGTTGAGTTTAGCAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-974s1c1
Sequence:CCGGCCCTGCAATCAGGCGAATTATCTCGAGATAATTCGCCTGATTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-504s1c1
Sequence:CCGGGCACCCTTAATCCTTACAGATCTCGAGATCTGTAAGGATTAAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-1621s1c1
Sequence:CCGGCGAGATGCTATCCTTGCAGAACTCGAGTTCTGCAAGGATAGCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011324.2-925s21c1
Sequence:CCGCTGCTTTGCTGTTCGAGGAATACTCGAGTATTCCTCGAACAGCAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011324.2-615s21c1
Sequence:CCGGGATCCATGAAGGGCAACAATTCTCGAGAATTGTTGCCCTTCATGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011324
SCNN1A MISSION shRNA Lentiviral Transduction Particles
sodium channel, non-voltage-gated 1 alpha subunit
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011324.1-2827s1c1
Sequence:CCGGGCTGTATTAGATGCTCACATTCTCGAGAATGTGAGCATCTAATACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-1669s1c1
Sequence:CCGGCGGAGTTGCTAAACTCAACATCTCGAGATGTTGAGTTTAGCAACTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-974s1c1
Sequence:CCGGCCCTGCAATCAGGCGAATTATCTCGAGATAATTCGCCTGATTGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-504s1c1
Sequence:CCGGGCACCCTTAATCCTTACAGATCTCGAGATCTGTAAGGATTAAGGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011324.1-1621s1c1
Sequence:CCGGCGAGATGCTATCCTTGCAGAACTCGAGTTCTGCAAGGATAGCATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011324.2-925s21c1
Sequence:CCGCTGCTTTGCTGTTCGAGGAATACTCGAGTATTCCTCGAACAGCAAAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011324.2-615s21c1
Sequence:CCGGGATCCATGAAGGGCAACAATTCTCGAGAATTGTTGCCCTTCATGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)