EMAIL THIS PAGE TO A FRIEND

SCNN1B

sodium channel, non-voltage-gated 1, beta subunit

96 Gene Product Result for
Synonyms: BESC1 ENaCb ENaCbeta SCNEB
UniProtKB ID: P51168, C5HTZ2, O60891, Q96KG2, Q9UJ32, Q9UMU5
Gene ID:
Human(6338) Summary: Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the beta subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), and Liddle syndrome. [provided by RefSeq, Apr 2009]
Mouse(20277) sodium channel, nonvoltage-gated 1 beta
Rat(24767) sodium channel, nonvoltage-gated 1, beta
chicken(427673) sodium channel, non-voltage-gated 1, beta subunit
Horse(100069008) sodium channel, non-voltage-gated 1, beta subunit
domestic cat(101099767) sodium channel, non-voltage-gated 1, beta subunit
dog(489972) sodium channel, non-voltage-gated 1, beta subunit
domestic guinea pig(100270805) sodium channel, nonvoltage-gated 1 beta
naked mole-rat(101717352) sodium channel, non-voltage-gated 1, beta subunit
Domestic Rabbit(100009564) sodium channel, non-voltage-gated 1, beta subunit
cow(533355) sodium channel, nonvoltage-gated 1, beta
sheep(100170325) sodium channel, non-voltage-gated 1, beta subunit
Goat(100861026) sodium channel, non-voltage-gated 1, beta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB3532P Anti-Epithelial Sodium Channel-β Antibody clone, Chemicon®, from rabbit rat, mouse
ELISA, western blot pricing
SAB4504262 Anti-phospho-Nonvoltage-gated Sodium Channel 1 (pThr615) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5200106 Anti-SCNN1B antibody produced in rabbit 1 mg/mL, affinity isolated antibody mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA015612 Anti-SCNN1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB5201788 Monoclonal Anti-ENaC beta antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201806 Monoclonal Anti-ENaC beta antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201797 Monoclonal Anti-ENaC beta-Alkaline Phosphatase antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201815 Monoclonal Anti-ENaC beta-Alkaline Phosphatase antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201798 Monoclonal Anti-ENaC beta-Allophycocyanin antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201816 Monoclonal Anti-ENaC beta-Allophycocyanin antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201789 Monoclonal Anti-ENaC beta-Atto 390 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201807 Monoclonal Anti-ENaC beta-Atto 390 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201790 Monoclonal Anti-ENaC beta-Atto 488 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201808 Monoclonal Anti-ENaC beta-Atto 488 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201792 Monoclonal Anti-ENaC beta-Atto 594 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201810 Monoclonal Anti-ENaC beta-Atto 594 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201791 Monoclonal Anti-ENaC beta-Atto 595 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201809 Monoclonal Anti-ENaC beta-Atto 595 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201793 Monoclonal Anti-ENaC beta-Atto 633 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201811 Monoclonal Anti-ENaC beta-Atto 633 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201794 Monoclonal Anti-ENaC beta-Atto 655 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201812 Monoclonal Anti-ENaC beta-Atto 655 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201795 Monoclonal Anti-ENaC beta-Atto 680 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201813 Monoclonal Anti-ENaC beta-Atto 680 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201796 Monoclonal Anti-ENaC beta-Atto 700 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201814 Monoclonal Anti-ENaC beta-Atto 700 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201799 Monoclonal Anti-ENaC beta-Biotin antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201817 Monoclonal Anti-ENaC beta-Biotin antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201800 Monoclonal Anti-ENaC beta-FITC antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201818 Monoclonal Anti-ENaC beta-FITC antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201801 Monoclonal Anti-ENaC beta-Horseradish Peroxidase antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201819 Monoclonal Anti-ENaC beta-Horseradish Peroxidase antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201802 Monoclonal Anti-ENaC beta-PE/Atto 594 antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201820 Monoclonal Anti-ENaC beta-PE/Atto 594 antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201803 Monoclonal Anti-ENaC beta-PerCP antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201821 Monoclonal Anti-ENaC beta-PerCP antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201804 Monoclonal Anti-ENaC beta-R-Phycoerythrin antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201822 Monoclonal Anti-ENaC beta-R-Phycoerythrin antibody produced in mouse clone 16E4 mouse
western blot pricing
SAB5201805 Monoclonal Anti-ENaC beta-Streptavidin antibody produced in mouse clone 7B8 mouse
immunohistochemistry, western blot pricing
SAB5201823 Monoclonal Anti-ENaC beta-Streptavidin antibody produced in mouse clone 16E4 mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000336 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066451 MISSION® esiRNA targeting human SCNN1B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000336 Rosetta Predictions human pricing
NM_012648 Rosetta Predictions rat pricing
NM_011325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155449 predicted 1710
2 SASI_Hs01_00155450 predicted 771
3 SASI_Hs01_00155451 predicted 671
4 SASI_Hs01_00155452 predicted 1348
5 SASI_Hs01_00155453 predicted 949
6 SASI_Hs01_00155454 predicted 1671
7 SASI_Hs01_00155455 predicted 1807
8 SASI_Hs01_00155456 predicted 1299
9 SASI_Hs01_00155457 predicted 1516
10 SASI_Hs02_00302355 predicted 1042
11 SASI_Hs01_00155458 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121326 predicted 643
2 SASI_Rn01_00121327 predicted 828
3 SASI_Rn01_00121328 predicted 1171
4 SASI_Rn01_00121329 predicted 1668
5 SASI_Rn01_00121330 predicted 1248
6 SASI_Rn01_00121331 predicted 1512
7 SASI_Rn02_00259894 predicted 1109
8 SASI_Rn01_00121334 predicted 942
9 SASI_Rn02_00259895 predicted 1549
10 SASI_Rn02_00259896 predicted 1565
11 SASI_Rn01_00121325 predicted 1587
12 SASI_Rn01_00121332 predicted 916
13 SASI_Rn01_00121333 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320416 predicted 1206
2 SASI_Mm02_00320417 predicted 1218
3 SASI_Mm02_00320418 predicted 1981
4 SASI_Mm02_00320419 predicted 1150
5 SASI_Mm02_00320420 predicted 1371
6 SASI_Mm02_00320421 predicted 1298
7 SASI_Mm02_00320422 predicted 1507
8 SASI_Mm02_00320423 predicted 1490
9 SASI_Mm02_00320424 predicted 1525
10 SASI_Mm02_00320425 predicted 2010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011325
SCNN1B MISSION shRNA Bacterial Glycerol Stock
sodium channel, non-voltage-gated 1, beta subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-696s1c1
Sequence:CCGGGCCACCAACATCTTCTCACAACTCGAGTTGTGAGAAGATGTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-815s1c1
Sequence:CCGGGCCTATCTTCTACCCTGATTACTCGAGTAATCAGGGTAGAAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-1530s1c1
Sequence:CCGGGAGTTCAACTACCGTACCATTCTCGAGAATGGTACGGTAGTTGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-1425s1c1
Sequence:CCGGGCCTCTGAGGATTGGATCTTACTCGAGTAAGATCCAATCCTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-110s1c1
Sequence:CCGGGCTAGTGTGGTACTGCAATAACTCGAGTTATTGCAGTACCACACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011325
SCNN1B MISSION shRNA shRNA Plasmid DNA
sodium channel, non-voltage-gated 1, beta subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-696s1c1
Sequence:CCGGGCCACCAACATCTTCTCACAACTCGAGTTGTGAGAAGATGTTGGTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000069114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-815s1c1
Sequence:CCGGGCCTATCTTCTACCCTGATTACTCGAGTAATCAGGGTAGAAGATAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000069117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-1530s1c1
Sequence:CCGGGAGTTCAACTACCGTACCATTCTCGAGAATGGTACGGTAGTTGAACTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000069115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-1425s1c1
Sequence:CCGGGCCTCTGAGGATTGGATCTTACTCGAGTAAGATCCAATCCTCAGAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000069116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-110s1c1
Sequence:CCGGGCTAGTGTGGTACTGCAATAACTCGAGTTATTGCAGTACCACACTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011325
SCNN1B MISSION shRNA Lentiviral Transduction Particles
sodium channel, non-voltage-gated 1, beta subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-696s1c1
Sequence:CCGGGCCACCAACATCTTCTCACAACTCGAGTTGTGAGAAGATGTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-815s1c1
Sequence:CCGGGCCTATCTTCTACCCTGATTACTCGAGTAATCAGGGTAGAAGATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-1530s1c1
Sequence:CCGGGAGTTCAACTACCGTACCATTCTCGAGAATGGTACGGTAGTTGAACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-1425s1c1
Sequence:CCGGGCCTCTGAGGATTGGATCTTACTCGAGTAAGATCCAATCCTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011325.1-110s1c1
Sequence:CCGGGCTAGTGTGGTACTGCAATAACTCGAGTTATTGCAGTACCACACTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000336
SCNN1B MISSION shRNA Bacterial Glycerol Stock
sodium channel, non-voltage-gated 1, beta subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-608s1c1
Sequence:CCGGCCCATGGTCCTTGATCTCTTTCTCGAGAAAGAGATCAAGGACCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-703s1c1
Sequence:CCGGCATGAGACTATGTAGCCTCAACTCGAGTTGAGGCTACATAGTCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1009s1c1
Sequence:CCGGCCTGAAGTTGATCCTGGACATCTCGAGATGTCCAGGATCAACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1762s1c1
Sequence:CCGGCGACTTTGTGTGGATCACCATCTCGAGATGGTGATCCACACAAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1628s1c1
Sequence:CCGGGAATTTAACTATCGCACCATTCTCGAGAATGGTGCGATAGTTAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1134s21c1
Sequence:CCGGCTTCACGAGCAGAGGTCATACCTCGAGGTATGACCTCTGCTCGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1350s21c1
Sequence:CCGGCAAGACCACATGATCCGTAACCTCGAGGTTACGGATCATGTGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1610s21c1
Sequence:CCGGGCGGGACCAAAGCACCAATATCTCGAGATATTGGTGCTTTGGTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000336
SCNN1B MISSION shRNA shRNA Plasmid DNA
sodium channel, non-voltage-gated 1, beta subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-608s1c1
Sequence:CCGGCCCATGGTCCTTGATCTCTTTCTCGAGAAAGAGATCAAGGACCATGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-703s1c1
Sequence:CCGGCATGAGACTATGTAGCCTCAACTCGAGTTGAGGCTACATAGTCTCATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1009s1c1
Sequence:CCGGCCTGAAGTTGATCCTGGACATCTCGAGATGTCCAGGATCAACTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1762s1c1
Sequence:CCGGCGACTTTGTGTGGATCACCATCTCGAGATGGTGATCCACACAAAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1628s1c1
Sequence:CCGGGAATTTAACTATCGCACCATTCTCGAGAATGGTGCGATAGTTAAATTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000437903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1134s21c1
Sequence:CCGGCTTCACGAGCAGAGGTCATACCTCGAGGTATGACCTCTGCTCGTGAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000415238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1350s21c1
Sequence:CCGGCAAGACCACATGATCCGTAACCTCGAGGTTACGGATCATGTGGTCTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000437321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1610s21c1
Sequence:CCGGGCGGGACCAAAGCACCAATATCTCGAGATATTGGTGCTTTGGTCCCGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000336
SCNN1B MISSION shRNA Lentiviral Transduction Particles
sodium channel, non-voltage-gated 1, beta subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-608s1c1
Sequence:CCGGCCCATGGTCCTTGATCTCTTTCTCGAGAAAGAGATCAAGGACCATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-703s1c1
Sequence:CCGGCATGAGACTATGTAGCCTCAACTCGAGTTGAGGCTACATAGTCTCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1009s1c1
Sequence:CCGGCCTGAAGTTGATCCTGGACATCTCGAGATGTCCAGGATCAACTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1762s1c1
Sequence:CCGGCGACTTTGTGTGGATCACCATCTCGAGATGGTGATCCACACAAAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000336.1-1628s1c1
Sequence:CCGGGAATTTAACTATCGCACCATTCTCGAGAATGGTGCGATAGTTAAATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1134s21c1
Sequence:CCGGCTTCACGAGCAGAGGTCATACCTCGAGGTATGACCTCTGCTCGTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1350s21c1
Sequence:CCGGCAAGACCACATGATCCGTAACCTCGAGGTTACGGATCATGTGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000336.2-1610s21c1
Sequence:CCGGGCGGGACCAAAGCACCAATATCTCGAGATATTGGTGCTTTGGTCCCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)