EMAIL THIS PAGE TO A FRIEND

SCNN1D

sodium channel, non-voltage-gated 1, delta subunit

28 Gene Product Result for
Synonyms: ENaCd ENaCdelta SCNED dNaCh
Gene ID:
cow(528813) sodium channel, non-voltage-gated 1, delta subunit
sheep(101105267) sodium channel, non-voltage-gated 1, delta subunit
naked mole-rat(101714354) sodium channel, non-voltage-gated 1, delta subunit
domestic guinea pig(100714892) sodium channel, non-voltage-gated 1, delta subunit
chicken(428184) sodium channel, non-voltage-gated 1, delta subunit
dog(489598) sodium channel, non-voltage-gated 1, delta subunit
domestic cat(101083756) sodium channel, non-voltage-gated 1, delta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002978 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141361 MISSION® esiRNA targeting human SCNN1D human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002978 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181983 predicted 1577
2 SASI_Hs01_00181984 predicted 2221
3 SASI_Hs01_00181985 predicted 1023
4 SASI_Hs01_00181986 predicted 864
5 SASI_Hs01_00181987 predicted 735
6 SASI_Hs01_00181988 predicted 644
7 SASI_Hs01_00181989 predicted 1711
8 SASI_Hs01_00181990 predicted 1136
9 SASI_Hs01_00181991 predicted 1447
10 SASI_Hs02_00334851 predicted 1454
11 SASI_Hs01_00181982 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002978
SCNN1D MISSION shRNA Bacterial Glycerol Stock
sodium channel, non-voltage-gated 1, delta subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002978.2-866s21c1
Sequence:CCGGCCACTTCCACTATGTGGATATCTCGAGATATCCACATAGTGGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002978.2-941s21c1
Sequence:CCGGCTTCGTCCTCTCCTGCAGTTACTCGAGTAACTGCAGGAGAGGACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-1307s1c1
Sequence:CCGGGCTGCTACACAACACCTCCTACTCGAGTAGGAGGTGTTGTGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-345s1c1
Sequence:CCGGCTCACCTTCTTCTGCACCAATCTCGAGATTGGTGCAGAAGAAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-638s1c1
Sequence:CCGGGAACATTGACTCCCTGTACAACTCGAGTTGTACAGGGAGTCAATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-824s1c1
Sequence:CCGGCCGAGGCTACACGTCAGGCGTCTCGAGACGCCTGACGTGTAGCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-1985s1c1
Sequence:CCGGGCCTCATCTCCCACGGGTGATCTCGAGATCACCCGTGGGAGATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002978
SCNN1D MISSION shRNA shRNA Plasmid DNA
sodium channel, non-voltage-gated 1, delta subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002978.2-866s21c1
Sequence:CCGGCCACTTCCACTATGTGGATATCTCGAGATATCCACATAGTGGAAGTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002978.2-941s21c1
Sequence:CCGGCTTCGTCCTCTCCTGCAGTTACTCGAGTAACTGCAGGAGAGGACGAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-1307s1c1
Sequence:CCGGGCTGCTACACAACACCTCCTACTCGAGTAGGAGGTGTTGTGTAGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-345s1c1
Sequence:CCGGCTCACCTTCTTCTGCACCAATCTCGAGATTGGTGCAGAAGAAGGTGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-638s1c1
Sequence:CCGGGAACATTGACTCCCTGTACAACTCGAGTTGTACAGGGAGTCAATGTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-824s1c1
Sequence:CCGGCCGAGGCTACACGTCAGGCGTCTCGAGACGCCTGACGTGTAGCCTCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-1985s1c1
Sequence:CCGGGCCTCATCTCCCACGGGTGATCTCGAGATCACCCGTGGGAGATGAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002978
SCNN1D MISSION shRNA Lentiviral Transduction Particles
sodium channel, non-voltage-gated 1, delta subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002978.2-866s21c1
Sequence:CCGGCCACTTCCACTATGTGGATATCTCGAGATATCCACATAGTGGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002978.2-941s21c1
Sequence:CCGGCTTCGTCCTCTCCTGCAGTTACTCGAGTAACTGCAGGAGAGGACGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-1307s1c1
Sequence:CCGGGCTGCTACACAACACCTCCTACTCGAGTAGGAGGTGTTGTGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-345s1c1
Sequence:CCGGCTCACCTTCTTCTGCACCAATCTCGAGATTGGTGCAGAAGAAGGTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-638s1c1
Sequence:CCGGGAACATTGACTCCCTGTACAACTCGAGTTGTACAGGGAGTCAATGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-824s1c1
Sequence:CCGGCCGAGGCTACACGTCAGGCGTCTCGAGACGCCTGACGTGTAGCCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002978.2-1985s1c1
Sequence:CCGGGCCTCATCTCCCACGGGTGATCTCGAGATCACCCGTGGGAGATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)