EMAIL THIS PAGE TO A FRIEND

SCNN1G

sodium channel, non-voltage-gated 1, gamma subunit

77 Gene Product Result for
Synonyms: BESC3 ENaCg ENaCgamma PHA1 SCNEG
Gene ID:
Human(6340) Summary: Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the gamma subunit, and mutations in this gene have been associated with Liddle syndrome. [provided by RefSeq, Apr 2009]
Mouse(20278) sodium channel, nonvoltage-gated 1 gamma
Rat(24768) sodium channel, nonvoltage-gated 1, gamma
chicken(416579) sodium channel, non-voltage-gated 1, gamma subunit
domestic cat(101100020) sodium channel, non-voltage-gated 1, gamma subunit
dog(489973) sodium channel, non-voltage-gated 1, gamma subunit
domestic guinea pig(100270806) sodium channel, nonvoltage-gated 1 gamma
naked mole-rat(101716529) sodium channel, non-voltage-gated 1, gamma subunit
Domestic Rabbit(100008850) sodium channel, non-voltage-gated 1, gamma subunit
cow(617802) sodium channel, nonvoltage-gated 1, gamma
sheep(100170326) sodium channel, non-voltage-gated 1, gamma subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022951 MISSION® esiRNA esiRNA human SCNN1G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039 Rosetta Predictions human pricing
NM_017046 Rosetta Predictions rat pricing
NM_011326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216723 predicted 1627
2 SASI_Hs01_00216724 predicted 1042
3 SASI_Hs01_00216725 predicted 1426
4 SASI_Hs01_00216726 predicted 1903
5 SASI_Hs01_00216727 predicted 1914
6 SASI_Hs01_00216728 predicted 1114
7 SASI_Hs01_00216729 predicted 698
8 SASI_Hs01_00216730 predicted 1038
9 SASI_Hs01_00216731 predicted 815
10 SASI_Hs02_00308414 predicted 1171
11 SASI_Hs01_00216732 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105177 predicted 2142
2 SASI_Rn02_00261231 predicted 1001
3 SASI_Rn01_00105178 predicted 839
4 SASI_Rn01_00105179 predicted 1455
5 SASI_Rn01_00105180 predicted 783
6 SASI_Rn01_00105181 predicted 1447
7 SASI_Rn01_00105182 predicted 664
8 SASI_Rn01_00105183 predicted 1556
9 SASI_Rn01_00105184 predicted 364
10 SASI_Rn01_00105186 predicted 1528
11 SASI_Rn01_00105185 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114623 predicted 2030
2 SASI_Mm01_00114624 predicted 764
3 SASI_Mm01_00114625 predicted 1729
4 SASI_Mm01_00114626 predicted 1434
5 SASI_Mm01_00114627 predicted 638
6 SASI_Mm02_00320426 predicted 750
7 SASI_Mm01_00114630 predicted 1254
8 SASI_Mm01_00114631 predicted 1438
9 SASI_Mm02_00320427 predicted 1235
10 SASI_Mm01_00114632 predicted 1740
11 SASI_Mm01_00114628 predicted 1541
12 SASI_Mm01_00114629 predicted 2136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039
SCNN1G MISSION shRNA Bacterial Glycerol Stock
sodium channel, non-voltage-gated 1, gamma subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001039.2-3162s1c1
Sequence:CCGGGCACCTAGATAGGTTAGCATACTCGAGTATGCTAACCTATCTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1273s1c1
Sequence:CCGGCGTGCCAATCAGGAACATCTACTCGAGTAGATGTTCCTGATTGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1696s1c1
Sequence:CCGGCCCAGCCAACAGTATTGAGATCTCGAGATCTCAATACTGTTGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1789s1c1
Sequence:CCGGCGAGGTCTTCTTCATTGACTTCTCGAGAAGTCAATGAAGAAGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-205s1c1
Sequence:CCGGGCCGACCATTAAAGAGCTGATCTCGAGATCAGCTCTTTAATGGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039
SCNN1G MISSION shRNA shRNA Plasmid DNA
sodium channel, non-voltage-gated 1, gamma subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001039.2-3162s1c1
Sequence:CCGGGCACCTAGATAGGTTAGCATACTCGAGTATGCTAACCTATCTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1273s1c1
Sequence:CCGGCGTGCCAATCAGGAACATCTACTCGAGTAGATGTTCCTGATTGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1696s1c1
Sequence:CCGGCCCAGCCAACAGTATTGAGATCTCGAGATCTCAATACTGTTGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1789s1c1
Sequence:CCGGCGAGGTCTTCTTCATTGACTTCTCGAGAAGTCAATGAAGAAGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-205s1c1
Sequence:CCGGGCCGACCATTAAAGAGCTGATCTCGAGATCAGCTCTTTAATGGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039
SCNN1G MISSION shRNA Lentiviral Transduction Particles
sodium channel, non-voltage-gated 1, gamma subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001039.2-3162s1c1
Sequence:CCGGGCACCTAGATAGGTTAGCATACTCGAGTATGCTAACCTATCTAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1273s1c1
Sequence:CCGGCGTGCCAATCAGGAACATCTACTCGAGTAGATGTTCCTGATTGGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1696s1c1
Sequence:CCGGCCCAGCCAACAGTATTGAGATCTCGAGATCTCAATACTGTTGGCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-1789s1c1
Sequence:CCGGCGAGGTCTTCTTCATTGACTTCTCGAGAAGTCAATGAAGAAGACCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001039.2-205s1c1
Sequence:CCGGGCCGACCATTAAAGAGCTGATCTCGAGATCAGCTCTTTAATGGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011326
SCNN1G MISSION shRNA Bacterial Glycerol Stock
sodium channel, non-voltage-gated 1, gamma subunit
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000069140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1737s1c1
Sequence:CCGGCGAAGTCTTCTTCATTGATTTCTCGAGAAATCAATGAAGAAGACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-652s1c1
Sequence:CCGGGCTTCTAATGTCATGCACGTTCTCGAGAACGTGCATGACATTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1225s1c1
Sequence:CCGGCCCGTCACAAACATCTACAATCTCGAGATTGTAGATGTTTGTGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1716s1c1
Sequence:CCGGCGTCTGTGTCATCGAAATCATCTCGAGATGATTTCGATGACACAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011326
SCNN1G MISSION shRNA shRNA Plasmid DNA
sodium channel, non-voltage-gated 1, gamma subunit
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000069140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1737s1c1
Sequence:CCGGCGAAGTCTTCTTCATTGATTTCTCGAGAAATCAATGAAGAAGACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-652s1c1
Sequence:CCGGGCTTCTAATGTCATGCACGTTCTCGAGAACGTGCATGACATTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1225s1c1
Sequence:CCGGCCCGTCACAAACATCTACAATCTCGAGATTGTAGATGTTTGTGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1716s1c1
Sequence:CCGGCGTCTGTGTCATCGAAATCATCTCGAGATGATTTCGATGACACAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011326
SCNN1G MISSION shRNA Lentiviral Transduction Particles
sodium channel, non-voltage-gated 1, gamma subunit
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000069140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1737s1c1
Sequence:CCGGCGAAGTCTTCTTCATTGATTTCTCGAGAAATCAATGAAGAAGACTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-652s1c1
Sequence:CCGGGCTTCTAATGTCATGCACGTTCTCGAGAACGTGCATGACATTAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1225s1c1
Sequence:CCGGCCCGTCACAAACATCTACAATCTCGAGATTGTAGATGTTTGTGACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011326.1-1716s1c1
Sequence:CCGGCGTCTGTGTCATCGAAATCATCTCGAGATGATTTCGATGACACAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)