EMAIL THIS PAGE TO A FRIEND

SCT

secretin

41 Gene Product Result for
UniProtKB ID: P09683
Gene ID:
Human(6343) Summary: Secretin belongs to the glucagon family. This protein is an endocrine hormone and its major site of production is the endocrine S cells located in the proximal small intestinal mucosa. The release of active secretin is stimulated by either fatty acids or an acidic pH in the duodenum. This hormone stimulates the secretion of bicarbonate-rich pancreatic fluids and has also been shown to regulate the growth and development of the stomach, small intestine, and pancreas. Secretin deficiency has been implicated in autistic syndrome, suggesting that the hormone could have a neuroendocrine function in addition to its role in digestion. [provided by RefSeq, Jul 2008]
Mouse(20287) secretin
Rat(24769) secretin
fruit fly(252590) scooped thickvein
chicken(423015) secretin
dog(483407) secretin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021920 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156561 MISSION® esiRNA esiRNA human SCT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021920 Rosetta Predictions human pricing
NM_022670 Rosetta Predictions rat pricing
NM_011328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229125 predicted 326
2 SASI_Hs01_00229126 predicted 329
3 SASI_Hs01_00229127 predicted 153
4 SASI_Hs01_00229128 predicted 162
5 SASI_Hs01_00229129 predicted 250
6 SASI_Hs01_00229130 predicted 211
7 SASI_Hs01_00229131 predicted 195
8 SASI_Hs01_00229132 predicted 377
9 SASI_Hs01_00229133 predicted 377
10 SASI_Hs01_00229134 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076359 predicted 282
2 SASI_Rn01_00076360 predicted 300
3 SASI_Rn01_00076361 predicted 283
4 SASI_Rn01_00076362 predicted 296
5 SASI_Rn01_00076364 predicted 393
6 SASI_Rn01_00076365 predicted 279
7 SASI_Rn01_00076366 predicted 396
8 SASI_Rn01_00076367 predicted 472
9 SASI_Rn02_00263439 predicted 279
10 SASI_Rn02_00263440 predicted 488
11 SASI_Rn01_00076363 predicted 305
12 SASI_Rn01_00076368 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036817 predicted 279
2 SASI_Mm01_00036818 predicted 246
3 SASI_Mm01_00036819 predicted 279
4 SASI_Mm01_00036820 predicted 284
5 SASI_Mm01_00036822 predicted 248
6 SASI_Mm01_00036824 predicted 274
7 SASI_Mm02_00320428 predicted 203
8 SASI_Mm01_00036823 predicted 274
9 SASI_Mm02_00320429 predicted 259
10 SASI_Mm02_00320430 predicted 119
11 SASI_Mm01_00036821 predicted 276
12 SASI_Mm01_00036825 predicted 248
13 SASI_Mm01_00036826 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011328
SCT MISSION shRNA Bacterial Glycerol Stock
secretin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-298s21c1
Sequence:CCGGTCGAACACTCAGACCCTACAGCTCGAGCTGTAGGGTCTGAGTGTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-284s21c1
Sequence:CCGGTCTGCTTGCTGTGGTCGAACACTCGAGTGTTCGACCACAGCAAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-271s21c1
Sequence:CCGGTTAGAGGACCAGCTCTGCTTGCTCGAGCAAGCAGAGCTGGTCCTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-309s21c1
Sequence:CCGGGACCCTACAGGACTGGCTTCTCTCGAGAGAAGCCAGTCCTGTAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-121s21c1
Sequence:CCGGCCAAGACACTCAGACGGAATGCTCGAGCATTCCGTCTGAGTGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011328
SCT MISSION shRNA shRNA Plasmid DNA
secretin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-298s21c1
Sequence:CCGGTCGAACACTCAGACCCTACAGCTCGAGCTGTAGGGTCTGAGTGTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-284s21c1
Sequence:CCGGTCTGCTTGCTGTGGTCGAACACTCGAGTGTTCGACCACAGCAAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-271s21c1
Sequence:CCGGTTAGAGGACCAGCTCTGCTTGCTCGAGCAAGCAGAGCTGGTCCTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-309s21c1
Sequence:CCGGGACCCTACAGGACTGGCTTCTCTCGAGAGAAGCCAGTCCTGTAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-121s21c1
Sequence:CCGGCCAAGACACTCAGACGGAATGCTCGAGCATTCCGTCTGAGTGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011328
SCT MISSION shRNA Lentiviral Transduction Particles
secretin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-298s21c1
Sequence:CCGGTCGAACACTCAGACCCTACAGCTCGAGCTGTAGGGTCTGAGTGTTCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-284s21c1
Sequence:CCGGTCTGCTTGCTGTGGTCGAACACTCGAGTGTTCGACCACAGCAAGCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-271s21c1
Sequence:CCGGTTAGAGGACCAGCTCTGCTTGCTCGAGCAAGCAGAGCTGGTCCTCTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-309s21c1
Sequence:CCGGGACCCTACAGGACTGGCTTCTCTCGAGAGAAGCCAGTCCTGTAGGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011328.2-121s21c1
Sequence:CCGGCCAAGACACTCAGACGGAATGCTCGAGCATTCCGTCTGAGTGTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021920
SCT MISSION shRNA Bacterial Glycerol Stock
secretin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-334s21c1
Sequence:CCGGCCTGGGCCTATGGTTTCAGAACTCGAGTTCTGAAACCATAGGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-208s21c1
Sequence:CCGGCAGGACGCAGAGAACAGCATGCTCGAGCATGCTGTTCTCTGCGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-123s21c1
Sequence:CCGGGACGTTCACCAGCGAGCTCAGCTCGAGCTGAGCTCGCTGGTGAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-110s21c1
Sequence:CCGGGACACTCAGACGGGACGTTCACTCGAGTGAACGTCCCGTCTGAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-267s21c1
Sequence:CCGGAGGGTCCAACATGCCCATCCTCTCGAGAGGATGGGCATGTTGGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021920
SCT MISSION shRNA shRNA Plasmid DNA
secretin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-334s21c1
Sequence:CCGGCCTGGGCCTATGGTTTCAGAACTCGAGTTCTGAAACCATAGGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-208s21c1
Sequence:CCGGCAGGACGCAGAGAACAGCATGCTCGAGCATGCTGTTCTCTGCGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-123s21c1
Sequence:CCGGGACGTTCACCAGCGAGCTCAGCTCGAGCTGAGCTCGCTGGTGAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-110s21c1
Sequence:CCGGGACACTCAGACGGGACGTTCACTCGAGTGAACGTCCCGTCTGAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-267s21c1
Sequence:CCGGAGGGTCCAACATGCCCATCCTCTCGAGAGGATGGGCATGTTGGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021920
SCT MISSION shRNA Lentiviral Transduction Particles
secretin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-334s21c1
Sequence:CCGGCCTGGGCCTATGGTTTCAGAACTCGAGTTCTGAAACCATAGGCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-208s21c1
Sequence:CCGGCAGGACGCAGAGAACAGCATGCTCGAGCATGCTGTTCTCTGCGTCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-123s21c1
Sequence:CCGGGACGTTCACCAGCGAGCTCAGCTCGAGCTGAGCTCGCTGGTGAACGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-110s21c1
Sequence:CCGGGACACTCAGACGGGACGTTCACTCGAGTGAACGTCCCGTCTGAGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021920.2-267s21c1
Sequence:CCGGAGGGTCCAACATGCCCATCCTCTCGAGAGGATGGGCATGTTGGACCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)