EMAIL THIS PAGE TO A FRIEND

SCYL1

SCY1-like 1 (S. cerevisiae)

74 Gene Product Result for
Synonyms: GKLP NKTL NTKL P105 TAPK TEIF TRAP
Gene ID:
Human(57410) Summary: This gene encodes a transcriptional regulator belonging to the SCY1-like family of kinase-like proteins. The protein has a divergent N-terminal kinase domain that is thought to be catalytically inactive, and can bind specific DNA sequences through its C-terminal domain. It activates transcription of the telomerase reverse transcriptase and DNA polymerase beta genes. The protein has been localized to the nucleus, and also to the cytoplasm and centrosomes during mitosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(78891) SCY1-like 1 (S. cerevisiae)
Rat(293684) SCY1-like 1 (S. cerevisiae)
Horse(100057036) SCY1-like 1 (S. cerevisiae)
dog(483737) SCY1-like 1 (S. cerevisiae)
domestic cat(101085831) SCY1-like 1 (S. cerevisiae)
cow(515247) SCY1-like 1 (S. cerevisiae)
sheep(101122739) SCY1-like 1 (S. cerevisiae)
domestic guinea pig(100728976) SCY1-like 1 (S. cerevisiae)
naked mole-rat(101720792) SCY1-like 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048218 Rosetta Predictions human pricing
NM_020680 Rosetta Predictions human pricing
NM_001011938 Rosetta Predictions rat pricing
XM_574604 Rosetta Predictions rat pricing
NM_023912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311722 predicted 984
2 SASI_Hs02_00311723 predicted 868
3 SASI_Hs02_00311724 predicted 973
4 SASI_Hs02_00311725 predicted 311
5 SASI_Hs02_00311726 predicted 873
6 SASI_Hs02_00311727 predicted 1377
7 SASI_Hs02_00311728 predicted 1137
8 SASI_Hs02_00311729 predicted 1089
9 SASI_Hs02_00311730 predicted 1644
10 SASI_Hs02_00311731 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227914 predicted 989
2 SASI_Hs01_00227916 predicted 869
3 SASI_Hs01_00227917 predicted 979
4 SASI_Hs02_00353671 predicted 315
5 SASI_Hs02_00353672 predicted 868
6 SASI_Hs01_00227920 predicted 1370
7 SASI_Hs01_00227921 predicted 1132
8 SASI_Hs01_00227922 predicted 1086
9 SASI_Hs01_00227923 predicted 1649
10 SASI_Hs02_00353673 predicted 797
11 SASI_Hs01_00227915 predicted 1783
12 SASI_Hs01_00227918 predicted 2043
13 SASI_Hs01_00227919 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091450 predicted 1589
2 SASI_Rn01_00091451 predicted 1035
3 SASI_Rn01_00091452 predicted 718
4 SASI_Rn01_00091453 predicted 1494
5 SASI_Rn02_00199956 predicted 885
6 SASI_Rn01_00091454 predicted 2059
7 SASI_Rn01_00091455 predicted 2056
8 SASI_Rn01_00091456 predicted 813
9 SASI_Rn01_00091457 predicted 1073
10 SASI_Rn01_00091458 predicted 933
11 SASI_Rn01_00091459 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148164 predicted 1691
2 SASI_Rn01_00148165 predicted 1981
3 SASI_Rn01_00148166 predicted 1709
4 SASI_Rn01_00148167 predicted 2150
5 SASI_Rn01_00148168 predicted 1402
6 SASI_Rn01_00148169 predicted 2162
7 SASI_Rn01_00148170 predicted 1597
8 SASI_Rn01_00148171 predicted 2150
9 SASI_Rn01_00148172 predicted 1711
10 SASI_Rn01_00148173 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134950 predicted 1194
2 SASI_Mm01_00134952 predicted 973
3 SASI_Mm02_00327460 predicted 1549
4 SASI_Mm01_00134955 predicted 2030
5 SASI_Mm02_00327461 predicted 1432
6 SASI_Mm02_00327462 predicted 1323
7 SASI_Mm01_00134956 predicted 864
8 SASI_Mm01_00134957 predicted 1488
9 SASI_Mm02_00327463 predicted 984
10 SASI_Mm02_00327464 predicted 1658
11 SASI_Mm01_00134951 predicted 2109
12 SASI_Mm01_00134953 predicted 1352
13 SASI_Mm01_00134954 predicted 931
14 SASI_Mm01_00134958 predicted 1019
15 SASI_Mm01_00134959 predicted 1613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023912
VALIDATED
SCYL1 MISSION shRNA Bacterial Glycerol Stock
SCY1-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1569s21c1
Sequence:CCGGATGGACGACTGTGCCCATAAGCTCGAGCTTATGGGCACAGTCGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1218s21c1
Sequence:CCGGCCAACAGTCAACACGCAGATTCTCGAGAATCTGCGTGTTGACTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1662s21c1
Sequence:CCGGCGAAGCTTCCTGTCCAAATTACTCGAGTAATTTGGACAGGAAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023912.2-291s21c1
Sequence:CCGGCCCAACATCCTGGCCTATATCCTCGAGGATATAGGCCAGGATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023912.2-2216s21c1
Sequence:CCGGTCGGCTAGCTAGCGAATATAACTCGAGTTATATTCGCTAGCTAGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023912.1-986s1c1
Sequence:CCGGCGAAGATTTCTGTCGACACAACTCGAGTTGTGTCGACAGAAATCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1491s1c1
Sequence:CCGGAGAGCCACTAAGGACCCATTTCTCGAGAAATGGGTCCTTAGTGGCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1218s1c1
Sequence:CCGGCCAACAGTCAACACGCAGATTCTCGAGAATCTGCGTGTTGACTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1662s1c1
Sequence:CCGGCGAAGCTTCCTGTCCAAATTACTCGAGTAATTTGGACAGGAAGCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023912
VALIDATED
SCYL1 MISSION shRNA shRNA Plasmid DNA
SCY1-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1569s21c1
Sequence:CCGGATGGACGACTGTGCCCATAAGCTCGAGCTTATGGGCACAGTCGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1218s21c1
Sequence:CCGGCCAACAGTCAACACGCAGATTCTCGAGAATCTGCGTGTTGACTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1662s21c1
Sequence:CCGGCGAAGCTTCCTGTCCAAATTACTCGAGTAATTTGGACAGGAAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023912.2-291s21c1
Sequence:CCGGCCCAACATCCTGGCCTATATCCTCGAGGATATAGGCCAGGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023912.2-2216s21c1
Sequence:CCGGTCGGCTAGCTAGCGAATATAACTCGAGTTATATTCGCTAGCTAGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023912.1-986s1c1
Sequence:CCGGCGAAGATTTCTGTCGACACAACTCGAGTTGTGTCGACAGAAATCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1491s1c1
Sequence:CCGGAGAGCCACTAAGGACCCATTTCTCGAGAAATGGGTCCTTAGTGGCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1218s1c1
Sequence:CCGGCCAACAGTCAACACGCAGATTCTCGAGAATCTGCGTGTTGACTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1662s1c1
Sequence:CCGGCGAAGCTTCCTGTCCAAATTACTCGAGTAATTTGGACAGGAAGCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023912
VALIDATED
SCYL1 MISSION shRNA Lentiviral Transduction Particles
SCY1-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1569s21c1
Sequence:CCGGATGGACGACTGTGCCCATAAGCTCGAGCTTATGGGCACAGTCGTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1218s21c1
Sequence:CCGGCCAACAGTCAACACGCAGATTCTCGAGAATCTGCGTGTTGACTGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023912.2-1662s21c1
Sequence:CCGGCGAAGCTTCCTGTCCAAATTACTCGAGTAATTTGGACAGGAAGCTTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023912.2-291s21c1
Sequence:CCGGCCCAACATCCTGGCCTATATCCTCGAGGATATAGGCCAGGATGTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023912.2-2216s21c1
Sequence:CCGGTCGGCTAGCTAGCGAATATAACTCGAGTTATATTCGCTAGCTAGCCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023912.1-986s1c1
Sequence:CCGGCGAAGATTTCTGTCGACACAACTCGAGTTGTGTCGACAGAAATCTTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1491s1c1
Sequence:CCGGAGAGCCACTAAGGACCCATTTCTCGAGAAATGGGTCCTTAGTGGCTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1218s1c1
Sequence:CCGGCCAACAGTCAACACGCAGATTCTCGAGAATCTGCGTGTTGACTGTTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023912.1-1662s1c1
Sequence:CCGGCGAAGCTTCCTGTCCAAATTACTCGAGTAATTTGGACAGGAAGCTTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020680
VALIDATED
SCYL1 MISSION shRNA Bacterial Glycerol Stock
SCY1-like 1 (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-201s21c1
Sequence:CCGGCCCGTGTCCATCTTCGTCTATCTCGAGATAGACGAAGATGGACACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-399s1c1
Sequence:CCGGGCTACACCAGATCGTGAAAGCCTCGAGGCTTTCACGATCTGGTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-996s1c1
Sequence:CCGGCGCCTTCGAGTTCGGCAATGCCTCGAGGCATTGCCGAACTCGAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-1630s1c1
Sequence:CCGGCGGAGCTTCCTGTCCAAATTGCTCGAGCAATTTGGACAGGAAGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-2409s1c1
Sequence:CCGGGCCCGGAAGCTGGACTGAACCCTCGAGGGTTCAGTCCAGCTTCCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-437s21c1
Sequence:CCGGGCTACACCAGATCGTGAAAGCCTCGAGGCTTTCACGATCTGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-1034s21c1
Sequence:CCGGCGCCTTCGAGTTCGGCAATGCCTCGAGGCATTGCCGAACTCGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020680.2-1638s1c1
Sequence:CCGGCCTGTCCAAATTGGAGTCTGTCTCGAGACAGACTCCAATTTGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-2417s1c1
Sequence:CCGGGCTGGACTGAACCGTGGCGGTCTCGAGACCGCCACGGTTCAGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-163s1c1
Sequence:CCGGCCCGTGTCCATCTTCGTCTATCTCGAGATAGACGAAGATGGACACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-2487s21c1
Sequence:CCGGGCCCGGAAGCTGGACTGAACCCTCGAGGGTTCAGTCCAGCTTCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-852s1c1
Sequence:CCGGCTTTGTAGAAACCAACCTCTTCTCGAGAAGAGGTTGGTTTCTACAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020680.2-330s1c1
Sequence:CCGGCCCGTTGGGAATATACCTCAACTCGAGTTGAGGTATATTCCCAACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020680
VALIDATED
SCYL1 MISSION shRNA shRNA Plasmid DNA
SCY1-like 1 (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-201s21c1
Sequence:CCGGCCCGTGTCCATCTTCGTCTATCTCGAGATAGACGAAGATGGACACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-399s1c1
Sequence:CCGGGCTACACCAGATCGTGAAAGCCTCGAGGCTTTCACGATCTGGTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-996s1c1
Sequence:CCGGCGCCTTCGAGTTCGGCAATGCCTCGAGGCATTGCCGAACTCGAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-1630s1c1
Sequence:CCGGCGGAGCTTCCTGTCCAAATTGCTCGAGCAATTTGGACAGGAAGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-2409s1c1
Sequence:CCGGGCCCGGAAGCTGGACTGAACCCTCGAGGGTTCAGTCCAGCTTCCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-437s21c1
Sequence:CCGGGCTACACCAGATCGTGAAAGCCTCGAGGCTTTCACGATCTGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-1034s21c1
Sequence:CCGGCGCCTTCGAGTTCGGCAATGCCTCGAGGCATTGCCGAACTCGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020680.2-1638s1c1
Sequence:CCGGCCTGTCCAAATTGGAGTCTGTCTCGAGACAGACTCCAATTTGGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-2417s1c1
Sequence:CCGGGCTGGACTGAACCGTGGCGGTCTCGAGACCGCCACGGTTCAGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-163s1c1
Sequence:CCGGCCCGTGTCCATCTTCGTCTATCTCGAGATAGACGAAGATGGACACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-2487s21c1
Sequence:CCGGGCCCGGAAGCTGGACTGAACCCTCGAGGGTTCAGTCCAGCTTCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-852s1c1
Sequence:CCGGCTTTGTAGAAACCAACCTCTTCTCGAGAAGAGGTTGGTTTCTACAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020680.2-330s1c1
Sequence:CCGGCCCGTTGGGAATATACCTCAACTCGAGTTGAGGTATATTCCCAACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020680
VALIDATED
SCYL1 MISSION shRNA Lentiviral Transduction Particles
SCY1-like 1 (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-201s21c1
Sequence:CCGGCCCGTGTCCATCTTCGTCTATCTCGAGATAGACGAAGATGGACACGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-399s1c1
Sequence:CCGGGCTACACCAGATCGTGAAAGCCTCGAGGCTTTCACGATCTGGTGTAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-996s1c1
Sequence:CCGGCGCCTTCGAGTTCGGCAATGCCTCGAGGCATTGCCGAACTCGAAGGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-1630s1c1
Sequence:CCGGCGGAGCTTCCTGTCCAAATTGCTCGAGCAATTTGGACAGGAAGCTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-2409s1c1
Sequence:CCGGGCCCGGAAGCTGGACTGAACCCTCGAGGGTTCAGTCCAGCTTCCGGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-437s21c1
Sequence:CCGGGCTACACCAGATCGTGAAAGCCTCGAGGCTTTCACGATCTGGTGTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-1034s21c1
Sequence:CCGGCGCCTTCGAGTTCGGCAATGCCTCGAGGCATTGCCGAACTCGAAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020680.2-1638s1c1
Sequence:CCGGCCTGTCCAAATTGGAGTCTGTCTCGAGACAGACTCCAATTTGGACAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-2417s1c1
Sequence:CCGGGCTGGACTGAACCGTGGCGGTCTCGAGACCGCCACGGTTCAGTCCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-163s1c1
Sequence:CCGGCCCGTGTCCATCTTCGTCTATCTCGAGATAGACGAAGATGGACACGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020680.3-2487s21c1
Sequence:CCGGGCCCGGAAGCTGGACTGAACCCTCGAGGGTTCAGTCCAGCTTCCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020680.2-852s1c1
Sequence:CCGGCTTTGTAGAAACCAACCTCTTCTCGAGAAGAGGTTGGTTTCTACAAAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020680.2-330s1c1
Sequence:CCGGCCCGTTGGGAATATACCTCAACTCGAGTTGAGGTATATTCCCAACGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???