EMAIL THIS PAGE TO A FRIEND

SDAD1

SDA1 domain containing 1

74 Gene Product Result for
UniProtKB ID: Q9NVU7, Q32Q11, Q68D52, Q7Z5U4, Q9H831, Q9H9P6
Gene ID:
Mouse(231452) SDA1 domain containing 1
Rat(289504) SDA1 domain containing 1
Zebrafish(286746) SDA1 domain containing 1
chicken(422642) SDA1 domain containing 1
dog(478431) SDA1 domain containing 1
Horse(100057877) SDA1 domain containing 1
domestic cat(101100640) SDA1 domain containing 1
cow(507675) SDA1 domain containing 1
sheep(101107964) SDA1 domain containing 1
naked mole-rat(101719717) SDA1 domain containing 1
Domestic Rabbit(100353366) SDA1 domain containing 1
domestic guinea pig(100723579) SDA1 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035949 Anti-SDAD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018115 Rosetta Predictions human pricing
NM_001006958 Rosetta Predictions rat pricing
NM_172713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168680 predicted 528
2 SASI_Hs02_00351319 predicted 643
3 SASI_Hs01_00168681 predicted 616
4 SASI_Hs01_00168682 predicted 1279
5 SASI_Hs02_00351320 predicted 215
6 SASI_Hs01_00168683 predicted 1382
7 SASI_Hs02_00351321 predicted 468
8 SASI_Hs02_00351322 predicted 204
9 SASI_Hs01_00168686 predicted 578
10 SASI_Hs01_00168687 predicted 520
11 SASI_Hs01_00168684 predicted 1411
12 SASI_Hs01_00168685 predicted 1262
13 SASI_Hs01_00168688 predicted 307
14 SASI_Hs01_00168689 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119136 predicted 605
2 SASI_Rn01_00119137 predicted 1333
3 SASI_Rn02_00198511 predicted 1442
4 SASI_Rn01_00119138 predicted 629
5 SASI_Rn01_00119141 predicted 1467
6 SASI_Rn01_00119142 predicted 1230
7 SASI_Rn01_00119143 predicted 1128
8 SASI_Rn01_00119144 predicted 1328
9 SASI_Rn01_00119145 predicted 1230
10 SASI_Rn02_00198512 predicted 795
11 SASI_Rn01_00119139 predicted 894
12 SASI_Rn01_00119140 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143950 predicted 2298
2 SASI_Mm01_00143951 predicted 998
3 SASI_Mm01_00143952 predicted 2198
4 SASI_Mm01_00143954 predicted 774
5 SASI_Mm01_00143955 predicted 2012
6 SASI_Mm01_00143956 predicted 236
7 SASI_Mm01_00143957 predicted 474
8 SASI_Mm01_00143959 predicted 1545
9 SASI_Mm02_00344491 predicted 398
10 SASI_Mm02_00344492 predicted 285
11 SASI_Mm01_00143953 predicted 1244
12 SASI_Mm01_00143958 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018115
VALIDATED
SDAD1 MISSION shRNA Bacterial Glycerol Stock
SDA1 domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-66s1c1
Sequence:CCGGCCCAGAGTACCTAAGTAATTTCTCGAGAAATTACTTAGGTACTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018115.1-2041s1c1
Sequence:CCGGGCTGAACATGTGGCAGCAATTCTCGAGAATTGCTGCCACATGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-1412s1c1
Sequence:CCGGCCGATGAAGAACAGCAAGAAACTCGAGTTTCTTGCTGTTCTTCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-1675s21c1
Sequence:CCGGCCGATGAAGAACAGCAAGAAACTCGAGTTTCTTGCTGTTCTTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-2304s21c1
Sequence:CCGGGCTGAACATGTGGCAGCAATTCTCGAGAATTGCTGCCACATGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-489s1c1
Sequence:CCGGCAAGATATTAGTTGCCGCTTTCTCGAGAAAGCGGCAACTAATATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-849s21c1
Sequence:CCGGAGAGACCTGCTAGTACAATATCTCGAGATATTGTACTAGCAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-752s21c1
Sequence:CCGGCAAGATATTAGTTGCCGCTTTCTCGAGAAAGCGGCAACTAATATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-329s21c1
Sequence:CCGGCCCAGAGTACCTAAGTAATTTCTCGAGAAATTACTTAGGTACTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018115
VALIDATED
SDAD1 MISSION shRNA shRNA Plasmid DNA
SDA1 domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-66s1c1
Sequence:CCGGCCCAGAGTACCTAAGTAATTTCTCGAGAAATTACTTAGGTACTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018115.1-2041s1c1
Sequence:CCGGGCTGAACATGTGGCAGCAATTCTCGAGAATTGCTGCCACATGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-1412s1c1
Sequence:CCGGCCGATGAAGAACAGCAAGAAACTCGAGTTTCTTGCTGTTCTTCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-1675s21c1
Sequence:CCGGCCGATGAAGAACAGCAAGAAACTCGAGTTTCTTGCTGTTCTTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-2304s21c1
Sequence:CCGGGCTGAACATGTGGCAGCAATTCTCGAGAATTGCTGCCACATGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-489s1c1
Sequence:CCGGCAAGATATTAGTTGCCGCTTTCTCGAGAAAGCGGCAACTAATATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-849s21c1
Sequence:CCGGAGAGACCTGCTAGTACAATATCTCGAGATATTGTACTAGCAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-752s21c1
Sequence:CCGGCAAGATATTAGTTGCCGCTTTCTCGAGAAAGCGGCAACTAATATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-329s21c1
Sequence:CCGGCCCAGAGTACCTAAGTAATTTCTCGAGAAATTACTTAGGTACTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018115
VALIDATED
SDAD1 MISSION shRNA Lentiviral Transduction Particles
SDA1 domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-66s1c1
Sequence:CCGGCCCAGAGTACCTAAGTAATTTCTCGAGAAATTACTTAGGTACTCTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018115.1-2041s1c1
Sequence:CCGGGCTGAACATGTGGCAGCAATTCTCGAGAATTGCTGCCACATGTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-1412s1c1
Sequence:CCGGCCGATGAAGAACAGCAAGAAACTCGAGTTTCTTGCTGTTCTTCATCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-1675s21c1
Sequence:CCGGCCGATGAAGAACAGCAAGAAACTCGAGTTTCTTGCTGTTCTTCATCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-2304s21c1
Sequence:CCGGGCTGAACATGTGGCAGCAATTCTCGAGAATTGCTGCCACATGTTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000146546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018115.1-489s1c1
Sequence:CCGGCAAGATATTAGTTGCCGCTTTCTCGAGAAAGCGGCAACTAATATCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-849s21c1
Sequence:CCGGAGAGACCTGCTAGTACAATATCTCGAGATATTGTACTAGCAGGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-752s21c1
Sequence:CCGGCAAGATATTAGTTGCCGCTTTCTCGAGAAAGCGGCAACTAATATCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018115.2-329s21c1
Sequence:CCGGCCCAGAGTACCTAAGTAATTTCTCGAGAAATTACTTAGGTACTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172713
VALIDATED
SDAD1 MISSION shRNA Bacterial Glycerol Stock
SDA1 domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172713.2-994s21c1
Sequence:CCGGTTTCAGCTATTCACTTGATTCCTCGAGGAATCAAGTGAATAGCTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172713.2-4818s21c1
Sequence:CCGGCAGTGTACATGTAGGTAATTACTCGAGTAATTACCTACATGTACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172713.2-2092s21c1
Sequence:CCGGACTTTATGATGATGCGGTATACTCGAGTATACCGCATCATCATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.2-2093s1c1
Sequence:CCGGCTTTATGATGATGCGGTATAGCTCGAGCTATACCGCATCATCATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-238s1c1
Sequence:CCGGCCTTCAGCAATATAACCACTACTCGAGTAGTGGTTATATTGCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-777s1c1
Sequence:CCGGCCAAGATATTGGTTGCTGCTTCTCGAGAAGCAGCAACCAATATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-1243s1c1
Sequence:CCGGCCCAGAGATTATTCAGTCGTTCTCGAGAACGACTGAATAATCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172713.2-1921s21c1
Sequence:CCGGTGCTGTCTCTTCGGGACATTGCTCGAGCAATGTCCCGAAGAGACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172713.2-2201s21c1
Sequence:CCGGGAAGTAACTTATCAGCAAATTCTCGAGAATTTGCTGATAAGTTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172713
VALIDATED
SDAD1 MISSION shRNA shRNA Plasmid DNA
SDA1 domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172713.2-994s21c1
Sequence:CCGGTTTCAGCTATTCACTTGATTCCTCGAGGAATCAAGTGAATAGCTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172713.2-4818s21c1
Sequence:CCGGCAGTGTACATGTAGGTAATTACTCGAGTAATTACCTACATGTACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172713.2-2092s21c1
Sequence:CCGGACTTTATGATGATGCGGTATACTCGAGTATACCGCATCATCATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.2-2093s1c1
Sequence:CCGGCTTTATGATGATGCGGTATAGCTCGAGCTATACCGCATCATCATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-238s1c1
Sequence:CCGGCCTTCAGCAATATAACCACTACTCGAGTAGTGGTTATATTGCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-777s1c1
Sequence:CCGGCCAAGATATTGGTTGCTGCTTCTCGAGAAGCAGCAACCAATATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-1243s1c1
Sequence:CCGGCCCAGAGATTATTCAGTCGTTCTCGAGAACGACTGAATAATCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172713.2-1921s21c1
Sequence:CCGGTGCTGTCTCTTCGGGACATTGCTCGAGCAATGTCCCGAAGAGACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172713.2-2201s21c1
Sequence:CCGGGAAGTAACTTATCAGCAAATTCTCGAGAATTTGCTGATAAGTTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172713
VALIDATED
SDAD1 MISSION shRNA Lentiviral Transduction Particles
SDA1 domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172713.2-994s21c1
Sequence:CCGGTTTCAGCTATTCACTTGATTCCTCGAGGAATCAAGTGAATAGCTGAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172713.2-4818s21c1
Sequence:CCGGCAGTGTACATGTAGGTAATTACTCGAGTAATTACCTACATGTACACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172713.2-2092s21c1
Sequence:CCGGACTTTATGATGATGCGGTATACTCGAGTATACCGCATCATCATAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.2-2093s1c1
Sequence:CCGGCTTTATGATGATGCGGTATAGCTCGAGCTATACCGCATCATCATAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-238s1c1
Sequence:CCGGCCTTCAGCAATATAACCACTACTCGAGTAGTGGTTATATTGCTGAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-777s1c1
Sequence:CCGGCCAAGATATTGGTTGCTGCTTCTCGAGAAGCAGCAACCAATATCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172713.1-1243s1c1
Sequence:CCGGCCCAGAGATTATTCAGTCGTTCTCGAGAACGACTGAATAATCTCTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172713.2-1921s21c1
Sequence:CCGGTGCTGTCTCTTCGGGACATTGCTCGAGCAATGTCCCGAAGAGACAGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172713.2-2201s21c1
Sequence:CCGGGAAGTAACTTATCAGCAAATTCTCGAGAATTTGCTGATAAGTTACTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???