EMAIL THIS PAGE TO A FRIEND

SDCBP

syndecan binding protein (syntenin)

209 Gene Product Result for
Synonyms: MDA-9 ST1 SYCL TACIP18
Gene ID:
Human(6386) Summary: The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(53378) syndecan binding protein
Rat(83841) syndecan binding protein
Zebrafish(325004) syndecan binding protein (syntenin)
domestic cat(101099858) syndecan binding protein (syntenin)
Horse(100052836) syndecan binding protein (syntenin)
chicken(421136) syndecan binding protein (syntenin)
dog(482977) syndecan binding protein (syntenin)
cow(510979) syndecan binding protein (syntenin)
sheep(101117086) syndecan binding protein (syntenin)
domestic guinea pig(100721404) syndecan binding protein (syntenin)
naked mole-rat(101700500) syndecan binding protein (syntenin)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007067 Rosetta Predictions human pricing
NM_001007068 Rosetta Predictions human pricing
NM_001007069 Rosetta Predictions human pricing
NM_001007070 Rosetta Predictions human pricing
NM_005625 Rosetta Predictions human pricing
NM_031986 Rosetta Predictions rat pricing
NM_001098227 Rosetta Predictions mouse pricing
NM_016807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305189 predicted 641
2 SASI_Hs01_00160437 predicted 613
3 SASI_Hs02_00305190 predicted 643
4 SASI_Hs01_00160434 predicted 888
5 SASI_Hs01_00160435 predicted 917
6 SASI_Hs02_00305191 predicted 735
7 SASI_Hs02_00305192 predicted 725
8 SASI_Hs02_00305193 predicted 929
9 SASI_Hs01_00160440 predicted 826
10 SASI_Hs02_00305194 predicted 755
11 SASI_Hs01_00160433 predicted 1152
12 SASI_Hs01_00160436 predicted 1191
13 SASI_Hs01_00160438 predicted 852
14 SASI_Hs01_00160439 predicted 1266
15 SASI_Hs01_00160441 predicted 1198
16 SASI_Hs01_00160442 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305195 predicted 627
2 SASI_Hs01_00232681 predicted 598
3 SASI_Hs02_00305196 predicted 631
4 SASI_Hs01_00232678 predicted 870
5 SASI_Hs01_00232679 predicted 897
6 SASI_Hs02_00305197 predicted 721
7 SASI_Hs02_00305198 predicted 703
8 SASI_Hs02_00305199 predicted 918
9 SASI_Hs01_00232684 predicted 817
10 SASI_Hs02_00305200 predicted 731
11 SASI_Hs01_00232677 predicted 1145
12 SASI_Hs01_00232680 predicted 1171
13 SASI_Hs01_00232682 predicted 840
14 SASI_Hs01_00232683 predicted 1243
15 SASI_Hs01_00232685 predicted 1183
16 SASI_Hs01_00232686 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188783 predicted 638
2 SASI_Hs01_00188784 predicted 605
3 SASI_Hs02_00305201 predicted 643
4 SASI_Hs01_00188781 predicted 887
5 SASI_Hs01_00188782 predicted 919
6 SASI_Hs02_00305202 predicted 732
7 SASI_Hs02_00305203 predicted 726
8 SASI_Hs02_00305204 predicted 926
9 SASI_Hs01_00188788 predicted 829
10 SASI_Hs02_00305205 predicted 746
11 SASI_Hs01_00188785 predicted 855
12 SASI_Hs01_00188786 predicted 895
13 SASI_Hs01_00188787 predicted 817
14 SASI_Hs01_00188789 predicted 853
15 SASI_Hs01_00188790 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104366 predicted 602
2 SASI_Hs02_00305206 predicted 1243
3 SASI_Hs01_00104368 predicted 1255
4 SASI_Hs01_00104362 predicted 1143
5 SASI_Hs01_00104363 predicted 885
6 SASI_Hs02_00305207 predicted 730
7 SASI_Hs02_00305208 predicted 930
8 SASI_Hs02_00305209 predicted 1177
9 SASI_Hs01_00104369 predicted 821
10 SASI_Hs01_00104370 predicted 1188
11 SASI_Hs01_00104364 predicted 913
12 SASI_Hs01_00104365 predicted 1189
13 SASI_Hs01_00104367 predicted 845
14 SASI_Hs01_00104371 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034381 predicted 644
2 SASI_Hs01_00034382 predicted 610
3 SASI_Hs02_00339950 predicted 647
4 SASI_Hs01_00034379 predicted 891
5 SASI_Hs01_00034380 predicted 922
6 SASI_Hs02_00339951 predicted 733
7 SASI_Hs02_00339952 predicted 723
8 SASI_Hs02_00339953 predicted 931
9 SASI_Hs01_00034386 predicted 835
10 SASI_Hs02_00339954 predicted 756
11 SASI_Hs01_00034383 predicted 851
12 SASI_Hs01_00034384 predicted 893
13 SASI_Hs01_00034385 predicted 827
14 SASI_Hs01_00034387 predicted 849
15 SASI_Hs01_00034388 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054281 predicted 947
2 SASI_Rn01_00054282 predicted 640
3 SASI_Rn01_00054283 predicted 668
4 SASI_Rn01_00054284 predicted 827
5 SASI_Rn01_00054285 predicted 452
6 SASI_Rn01_00054286 predicted 832
7 SASI_Rn02_00265384 predicted 813
8 SASI_Rn01_00054287 predicted 474
9 SASI_Rn01_00054289 predicted 646
10 SASI_Rn01_00054290 predicted 816
11 SASI_Rn01_00054288 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301297 predicted 1273
2 SASI_Mm02_00301298 predicted 708
3 SASI_Mm02_00301299 predicted 969
4 SASI_Mm02_00301300 predicted 674
5 SASI_Mm02_00301301 predicted 843
6 SASI_Mm02_00301302 predicted 1285
7 SASI_Mm02_00301303 predicted 1036
8 SASI_Mm02_00301304 predicted 1215
9 SASI_Mm02_00301305 predicted 689
10 SASI_Mm02_00301306 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323597 predicted 1271
2 SASI_Mm02_00323598 predicted 706
3 SASI_Mm01_00149329 predicted 965
4 SASI_Mm02_00323599 predicted 671
5 SASI_Mm01_00149331 predicted 841
6 SASI_Mm02_00323600 predicted 1278
7 SASI_Mm01_00149335 predicted 1031
8 SASI_Mm02_00323601 predicted 1218
9 SASI_Mm02_00323602 predicted 682
10 SASI_Mm02_00323603 predicted 996
11 SASI_Mm01_00149327 predicted 221
12 SASI_Mm01_00149328 predicted 432
13 SASI_Mm01_00149330 predicted 431
14 SASI_Mm01_00149332 predicted 644
15 SASI_Mm01_00149333 predicted 249
16 SASI_Mm01_00149334 predicted 760
17 SASI_Mm01_00149336 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005625
VALIDATED
SDCBP MISSION shRNA Bacterial Glycerol Stock
syndecan binding protein (syntenin)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-262s21c1
Sequence:CCGGCCTATCCCTCACGATGGAAATCTCGAGATTTCCATCGTGAGGGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005625.3-1428s21c1
Sequence:CCGGTATAGCATACTTGCATCTTTACTCGAGTAAAGATGCAAGTATGCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-622s21c1
Sequence:CCGGGTACTTCAGATCAATGGTGAACTCGAGTTCACCATTGATCTGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-464s1c1
Sequence:CCGGGCAGAAATTAAGCAAGGGATTCTCGAGAATCCCTTGCTTAATTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005625.1-849s1c1
Sequence:CCGGCGGAACATAACATCTGTGAAACTCGAGTTTCACAGATGTTATGTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-700s21c1
Sequence:CCGGGAGAAGATTACCATGACCATTCTCGAGAATGGTCATGGTAATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-399s21c1
Sequence:CCGGAGCAAGACCTTCCAGTATAAACTCGAGTTTATACTGGAAGGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-260s1c1
Sequence:CCGGCCTATCCCTCACGATGGAAATCTCGAGATTTCCATCGTGAGGGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-620s1c1
Sequence:CCGGGTACTTCAGATCAATGGTGAACTCGAGTTCACCATTGATCTGAAGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-698s1c1
Sequence:CCGGGAGAAGATTACCATGACCATTCTCGAGAATGGTCATGGTAATCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005625
VALIDATED
SDCBP MISSION shRNA shRNA Plasmid DNA
syndecan binding protein (syntenin)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-262s21c1
Sequence:CCGGCCTATCCCTCACGATGGAAATCTCGAGATTTCCATCGTGAGGGATAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005625.3-1428s21c1
Sequence:CCGGTATAGCATACTTGCATCTTTACTCGAGTAAAGATGCAAGTATGCTATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-622s21c1
Sequence:CCGGGTACTTCAGATCAATGGTGAACTCGAGTTCACCATTGATCTGAAGTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-464s1c1
Sequence:CCGGGCAGAAATTAAGCAAGGGATTCTCGAGAATCCCTTGCTTAATTTCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005625.1-849s1c1
Sequence:CCGGCGGAACATAACATCTGTGAAACTCGAGTTTCACAGATGTTATGTTCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-700s21c1
Sequence:CCGGGAGAAGATTACCATGACCATTCTCGAGAATGGTCATGGTAATCTTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-399s21c1
Sequence:CCGGAGCAAGACCTTCCAGTATAAACTCGAGTTTATACTGGAAGGTCTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-260s1c1
Sequence:CCGGCCTATCCCTCACGATGGAAATCTCGAGATTTCCATCGTGAGGGATAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-620s1c1
Sequence:CCGGGTACTTCAGATCAATGGTGAACTCGAGTTCACCATTGATCTGAAGTACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-698s1c1
Sequence:CCGGGAGAAGATTACCATGACCATTCTCGAGAATGGTCATGGTAATCTTCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005625
VALIDATED
SDCBP MISSION shRNA Lentiviral Transduction Particles
syndecan binding protein (syntenin)
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000293258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-262s21c1
Sequence:CCGGCCTATCCCTCACGATGGAAATCTCGAGATTTCCATCGTGAGGGATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005625.3-1428s21c1
Sequence:CCGGTATAGCATACTTGCATCTTTACTCGAGTAAAGATGCAAGTATGCTATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-622s21c1
Sequence:CCGGGTACTTCAGATCAATGGTGAACTCGAGTTCACCATTGATCTGAAGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-464s1c1
Sequence:CCGGGCAGAAATTAAGCAAGGGATTCTCGAGAATCCCTTGCTTAATTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005625.1-849s1c1
Sequence:CCGGCGGAACATAACATCTGTGAAACTCGAGTTTCACAGATGTTATGTTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-700s21c1
Sequence:CCGGGAGAAGATTACCATGACCATTCTCGAGAATGGTCATGGTAATCTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005625.3-399s21c1
Sequence:CCGGAGCAAGACCTTCCAGTATAAACTCGAGTTTATACTGGAAGGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-260s1c1
Sequence:CCGGCCTATCCCTCACGATGGAAATCTCGAGATTTCCATCGTGAGGGATAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-620s1c1
Sequence:CCGGGTACTTCAGATCAATGGTGAACTCGAGTTCACCATTGATCTGAAGTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005625.1-698s1c1
Sequence:CCGGGAGAAGATTACCATGACCATTCTCGAGAATGGTCATGGTAATCTTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016807
SDCBP MISSION shRNA Bacterial Glycerol Stock
syndecan binding protein (syntenin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016807.1-1545s1c1
Sequence:CCGGCGCCTTAACTACAGTAAGCATCTCGAGATGCTTACTGTAGTTAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-181s1c1
Sequence:CCGGGATGGAAATCTGTATCCTAAACTCGAGTTTAGGATACAGATTTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-879s1c1
Sequence:CCGGCGAACACATTATTAAACGGATCTCGAGATCCGTTTAATAATGTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-668s1c1
Sequence:CCGGGCAGTGGACATGTTGGCTTTACTCGAGTAAAGCCAACATGTCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-142s1c1
Sequence:CCGGGCATTTGTTCTGGTGGATGCTCTCGAGAGCATCCACCAGAACAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016807
SDCBP MISSION shRNA shRNA Plasmid DNA
syndecan binding protein (syntenin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016807.1-1545s1c1
Sequence:CCGGCGCCTTAACTACAGTAAGCATCTCGAGATGCTTACTGTAGTTAAGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-181s1c1
Sequence:CCGGGATGGAAATCTGTATCCTAAACTCGAGTTTAGGATACAGATTTCCATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-879s1c1
Sequence:CCGGCGAACACATTATTAAACGGATCTCGAGATCCGTTTAATAATGTGTTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-668s1c1
Sequence:CCGGGCAGTGGACATGTTGGCTTTACTCGAGTAAAGCCAACATGTCCACTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-142s1c1
Sequence:CCGGGCATTTGTTCTGGTGGATGCTCTCGAGAGCATCCACCAGAACAAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016807
SDCBP MISSION shRNA Lentiviral Transduction Particles
syndecan binding protein (syntenin)
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000093444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016807.1-1545s1c1
Sequence:CCGGCGCCTTAACTACAGTAAGCATCTCGAGATGCTTACTGTAGTTAAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-181s1c1
Sequence:CCGGGATGGAAATCTGTATCCTAAACTCGAGTTTAGGATACAGATTTCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-879s1c1
Sequence:CCGGCGAACACATTATTAAACGGATCTCGAGATCCGTTTAATAATGTGTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-668s1c1
Sequence:CCGGGCAGTGGACATGTTGGCTTTACTCGAGTAAAGCCAACATGTCCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016807.1-142s1c1
Sequence:CCGGGCATTTGTTCTGGTGGATGCTCTCGAGAGCATCCACCAGAACAAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)