EMAIL THIS PAGE TO A FRIEND

SDF4

stromal cell derived factor 4

64 Gene Product Result for
Synonyms: Cab45 SDF-4
Gene ID:
Human(51150) Summary: This gene encodes a stromal cell derived factor that is a member of the CREC protein family. The encoded protein contains six EF-hand motifs and calcium-binding motifs. This protein localizes to the Golgi lumen and may be involved in regulating calcium dependent cellular activities. [provided by RefSeq, Sep 2011]
Mouse(20318) stromal cell derived factor 4
Rat(155173) stromal cell derived factor 4
Zebrafish(406360) stromal cell derived factor 4
chicken(419423) stromal cell derived factor 4
dog(479572) stromal cell derived factor 4
domestic cat(101101374) stromal cell derived factor 4
cow(528783) stromal cell derived factor 4
Goat(100860787) stromal cell derived factor 4
sheep(101106026) stromal cell derived factor 4
naked mole-rat(101721571) stromal cell derived factor 4
domestic guinea pig(100731059) stromal cell derived factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016176 Rosetta Predictions human pricing
NM_016547 Rosetta Predictions human pricing
NM_130412 Rosetta Predictions rat pricing
NM_011341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117638 predicted 869
2 SASI_Hs01_00117639 predicted 865
3 SASI_Hs01_00117642 predicted 825
4 SASI_Hs01_00117645 predicted 527
5 SASI_Hs01_00117646 predicted 795
6 SASI_Hs01_00117647 predicted 838
7 SASI_Hs02_00348990 predicted 1665
8 SASI_Hs02_00348991 predicted 805
9 SASI_Hs02_00348992 predicted 686
10 SASI_Hs02_00348993 predicted 875
11 SASI_Hs01_00117640 predicted 804
12 SASI_Hs01_00117641 predicted 736
13 SASI_Hs01_00117643 predicted 567
14 SASI_Hs01_00117644 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141101 predicted 868
2 SASI_Hs01_00141102 predicted 868
3 SASI_Hs01_00141105 predicted 822
4 SASI_Hs01_00141108 predicted 530
5 SASI_Hs01_00141109 predicted 790
6 SASI_Hs01_00141110 predicted 846
7 SASI_Hs02_00349665 predicted 1779
8 SASI_Hs02_00349666 predicted 802
9 SASI_Hs02_00349667 predicted 683
10 SASI_Hs02_00349668 predicted 875
11 SASI_Hs01_00141103 predicted 829
12 SASI_Hs01_00141104 predicted 761
13 SASI_Hs01_00141106 predicted 595
14 SASI_Hs01_00141107 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031496 predicted 549
2 SASI_Rn02_00267407 predicted 382
3 SASI_Rn01_00031497 predicted 627
4 SASI_Rn01_00031498 predicted 1135
5 SASI_Rn01_00031499 predicted 281
6 SASI_Rn01_00031500 predicted 442
7 SASI_Rn01_00031501 predicted 556
8 SASI_Rn01_00031502 predicted 438
9 SASI_Rn01_00031503 predicted 589
10 SASI_Rn01_00031504 predicted 737
11 SASI_Rn01_00031505 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191022 predicted 886
2 SASI_Mm01_00191023 predicted 1292
3 SASI_Mm01_00191024 predicted 676
4 SASI_Mm01_00191025 predicted 920
5 SASI_Mm01_00191027 predicted 935
6 SASI_Mm01_00191028 predicted 442
7 SASI_Mm01_00191029 predicted 546
8 SASI_Mm01_00191030 predicted 670
9 SASI_Mm01_00191031 predicted 1148
10 SASI_Mm02_00320475 predicted 1210
11 SASI_Mm01_00191026 predicted 1379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016176
VALIDATED
SDF4 MISSION shRNA Bacterial Glycerol Stock
stromal cell derived factor 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016176.2-1280s1c1
Sequence:CCGGGCTCAAGTACAGCGAGTTCTTCTCGAGAAGAACTCGCTGTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-560s1c1
Sequence:CCGGCCGGAGGAAGCTGATGGTCATCTCGAGATGACCATCAGCTTCCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-819s1c1
Sequence:CCGGGAACTCAAAGTGGACGAGGAACTCGAGTTCCTCGTCCACTTTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-741s1c1
Sequence:CCGGGACGAGTATAAGGTGAAGTTTCTCGAGAAACTTCACCTTATACTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016176.3-1840s21c1
Sequence:CCGGAGATTAAACTTCGCTGGAAATCTCGAGATTTCCAGCGAAGTTTAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016176.2-1091s1c1
Sequence:CCGGCAACTGGGTGAAAGACAGAAACTCGAGTTTCTGTCTTTCACCCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-833s21c1
Sequence:CCGGGAGTAAAGGCCATAGCGAGAACTCGAGTTCTCGCTATGGCCTTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-874s21c1
Sequence:CCGGGGCTCAACGAGGAACTCAAAGCTCGAGCTTTGAGTTCCTCGTTGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-700s21c1
Sequence:CCGGAGCGCTGGATCATGGAGAAGACTCGAGTCTTCTCCATGATCCAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-662s21c1
Sequence:CCGGTGTGAACACTGACCGGAAGATCTCGAGATCTTCCGGTCAGTGTTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016176
VALIDATED
SDF4 MISSION shRNA shRNA Plasmid DNA
stromal cell derived factor 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016176.2-1280s1c1
Sequence:CCGGGCTCAAGTACAGCGAGTTCTTCTCGAGAAGAACTCGCTGTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-560s1c1
Sequence:CCGGCCGGAGGAAGCTGATGGTCATCTCGAGATGACCATCAGCTTCCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-819s1c1
Sequence:CCGGGAACTCAAAGTGGACGAGGAACTCGAGTTCCTCGTCCACTTTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-741s1c1
Sequence:CCGGGACGAGTATAAGGTGAAGTTTCTCGAGAAACTTCACCTTATACTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016176.3-1840s21c1
Sequence:CCGGAGATTAAACTTCGCTGGAAATCTCGAGATTTCCAGCGAAGTTTAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016176.2-1091s1c1
Sequence:CCGGCAACTGGGTGAAAGACAGAAACTCGAGTTTCTGTCTTTCACCCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-833s21c1
Sequence:CCGGGAGTAAAGGCCATAGCGAGAACTCGAGTTCTCGCTATGGCCTTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-874s21c1
Sequence:CCGGGGCTCAACGAGGAACTCAAAGCTCGAGCTTTGAGTTCCTCGTTGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-700s21c1
Sequence:CCGGAGCGCTGGATCATGGAGAAGACTCGAGTCTTCTCCATGATCCAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-662s21c1
Sequence:CCGGTGTGAACACTGACCGGAAGATCTCGAGATCTTCCGGTCAGTGTTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016176
VALIDATED
SDF4 MISSION shRNA Lentiviral Transduction Particles
stromal cell derived factor 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016176.2-1280s1c1
Sequence:CCGGGCTCAAGTACAGCGAGTTCTTCTCGAGAAGAACTCGCTGTACTTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-560s1c1
Sequence:CCGGCCGGAGGAAGCTGATGGTCATCTCGAGATGACCATCAGCTTCCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-819s1c1
Sequence:CCGGGAACTCAAAGTGGACGAGGAACTCGAGTTCCTCGTCCACTTTGAGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016176.2-741s1c1
Sequence:CCGGGACGAGTATAAGGTGAAGTTTCTCGAGAAACTTCACCTTATACTCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016176.3-1840s21c1
Sequence:CCGGAGATTAAACTTCGCTGGAAATCTCGAGATTTCCAGCGAAGTTTAATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016176.2-1091s1c1
Sequence:CCGGCAACTGGGTGAAAGACAGAAACTCGAGTTTCTGTCTTTCACCCAGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-833s21c1
Sequence:CCGGGAGTAAAGGCCATAGCGAGAACTCGAGTTCTCGCTATGGCCTTTACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-874s21c1
Sequence:CCGGGGCTCAACGAGGAACTCAAAGCTCGAGCTTTGAGTTCCTCGTTGAGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-700s21c1
Sequence:CCGGAGCGCTGGATCATGGAGAAGACTCGAGTCTTCTCCATGATCCAGCGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016176.3-662s21c1
Sequence:CCGGTGTGAACACTGACCGGAAGATCTCGAGATCTTCCGGTCAGTGTTCACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011341
VALIDATED
SDF4 MISSION shRNA Bacterial Glycerol Stock
stromal cell derived factor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011341.4-1741s21c1
Sequence:CCGGGCCCAGGTTTATTAAAGATATCTCGAGATATCTTTAATAAACCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1121s21c1
Sequence:CCGGCATGCTCAAGTTCATGGTCAACTCGAGTTGACCATGAACTTGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-639s1c1
Sequence:CCGGCACCTCAACAAGGACTTCCATCTCGAGATGGAAGTCCTTGTTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1237s21c1
Sequence:CCGGGCCAAGACATTGATGACAACTCTCGAGAGTTGTCATCAATGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011341.3-1741s1c1
Sequence:CCGGGCCCAGGTTTATTAAAGATATCTCGAGATATCTTTAATAAACCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1237s1c1
Sequence:CCGGGCCAAGACATTGATGACAACTCTCGAGAGTTGTCATCAATGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1121s1c1
Sequence:CCGGCATGCTCAAGTTCATGGTCAACTCGAGTTGACCATGAACTTGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1442s1c1
Sequence:CCGGCCTCAAGTACAGTGAGTTCTTCTCGAGAAGAACTCACTGTACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-639s21c1
Sequence:CCGGCACCTCAACAAGGACTTCCATCTCGAGATGGAAGTCCTTGTTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1442s21c1
Sequence:CCGGCCTCAAGTACAGTGAGTTCTTCTCGAGAAGAACTCACTGTACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011341
VALIDATED
SDF4 MISSION shRNA shRNA Plasmid DNA
stromal cell derived factor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011341.4-1741s21c1
Sequence:CCGGGCCCAGGTTTATTAAAGATATCTCGAGATATCTTTAATAAACCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1121s21c1
Sequence:CCGGCATGCTCAAGTTCATGGTCAACTCGAGTTGACCATGAACTTGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-639s1c1
Sequence:CCGGCACCTCAACAAGGACTTCCATCTCGAGATGGAAGTCCTTGTTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1237s21c1
Sequence:CCGGGCCAAGACATTGATGACAACTCTCGAGAGTTGTCATCAATGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011341.3-1741s1c1
Sequence:CCGGGCCCAGGTTTATTAAAGATATCTCGAGATATCTTTAATAAACCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1237s1c1
Sequence:CCGGGCCAAGACATTGATGACAACTCTCGAGAGTTGTCATCAATGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1121s1c1
Sequence:CCGGCATGCTCAAGTTCATGGTCAACTCGAGTTGACCATGAACTTGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1442s1c1
Sequence:CCGGCCTCAAGTACAGTGAGTTCTTCTCGAGAAGAACTCACTGTACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-639s21c1
Sequence:CCGGCACCTCAACAAGGACTTCCATCTCGAGATGGAAGTCCTTGTTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1442s21c1
Sequence:CCGGCCTCAAGTACAGTGAGTTCTTCTCGAGAAGAACTCACTGTACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011341
VALIDATED
SDF4 MISSION shRNA Lentiviral Transduction Particles
stromal cell derived factor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011341.4-1741s21c1
Sequence:CCGGGCCCAGGTTTATTAAAGATATCTCGAGATATCTTTAATAAACCTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000319816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1121s21c1
Sequence:CCGGCATGCTCAAGTTCATGGTCAACTCGAGTTGACCATGAACTTGAGCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-639s1c1
Sequence:CCGGCACCTCAACAAGGACTTCCATCTCGAGATGGAAGTCCTTGTTGAGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000319817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1237s21c1
Sequence:CCGGGCCAAGACATTGATGACAACTCTCGAGAGTTGTCATCAATGTCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011341.3-1741s1c1
Sequence:CCGGGCCCAGGTTTATTAAAGATATCTCGAGATATCTTTAATAAACCTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1237s1c1
Sequence:CCGGGCCAAGACATTGATGACAACTCTCGAGAGTTGTCATCAATGTCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1121s1c1
Sequence:CCGGCATGCTCAAGTTCATGGTCAACTCGAGTTGACCATGAACTTGAGCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011341.3-1442s1c1
Sequence:CCGGCCTCAAGTACAGTGAGTTCTTCTCGAGAAGAACTCACTGTACTTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000350127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-639s21c1
Sequence:CCGGCACCTCAACAAGGACTTCCATCTCGAGATGGAAGTCCTTGTTGAGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000350128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011341.4-1442s21c1
Sequence:CCGGCCTCAAGTACAGTGAGTTCTTCTCGAGAAGAACTCACTGTACTTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???