EMAIL THIS PAGE TO A FRIEND

SDHC

succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa

193 Gene Product Result for
Synonyms: CYB560 CYBL PGL3 QPS1 SDH3
UniProtKB ID: Q99643, O75609, Q3C259, Q3C2D8, Q3C2H4, Q5VTH3
Gene ID:
Human(6391) Summary: This gene encodes one of four nuclear-encoded subunits that comprise succinate dehydrogenase, also known as mitochondrial complex II, a key enzyme complex of the tricarboxylic acid cycle and aerobic respiratory chains of mitochondria. The encoded protein is one of two integral membrane proteins that anchor other subunits of the complex, which form the catalytic core, to the inner mitochondrial membrane. There are several related pseudogenes for this gene on different chromosomes. Mutations in this gene have been associated with paragangliomas. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2013]
Mouse(66052) succinate dehydrogenase complex, subunit C, integral membrane protein
Rat(289217) succinate dehydrogenase complex, subunit C, integral membrane protein
fruit fly(41340) Succinate dehydrogenase C
Zebrafish(445129) succinate dehydrogenase complex, subunit C, integral membrane protein
chicken(100859641) succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
domestic cat(101087808) succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
dog(478983) succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
domestic guinea pig(100728963) succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
naked mole-rat(101698043) succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
cow(327696) succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
sheep(101105616) succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK197 Succinate Dehydrogenase Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003001 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035511 Rosetta Predictions human pricing
NM_001035512 Rosetta Predictions human pricing
NM_001035513 Rosetta Predictions human pricing
NM_003001 Rosetta Predictions human pricing
NM_001005534 Rosetta Predictions rat pricing
NM_025321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132579 predicted 638
2 SASI_Hs01_00132580 predicted 799
3 SASI_Hs01_00132581 predicted 854
4 SASI_Hs01_00132582 predicted 849
5 SASI_Hs01_00132583 predicted 627
6 SASI_Hs01_00132584 predicted 842
7 SASI_Hs01_00132585 predicted 513
8 SASI_Hs02_00308192 predicted 972
9 SASI_Hs01_00132586 predicted 925
10 SASI_Hs01_00132587 predicted 694
11 SASI_Hs01_00132588 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079559 predicted 698
2 SASI_Hs01_00079560 predicted 898
3 SASI_Hs01_00079561 predicted 53
4 SASI_Hs01_00079563 predicted 689
5 SASI_Hs01_00079564 predicted 528
6 SASI_Hs01_00079565 predicted 525
7 SASI_Hs02_00308193 predicted 71
8 SASI_Hs02_00308194 predicted 575
9 SASI_Hs02_00308195 predicted 216
10 SASI_Hs02_00308196 predicted 497
11 SASI_Hs01_00079562 predicted 201
12 SASI_Hs01_00079566 predicted 276
13 SASI_Hs01_00079567 predicted 255
14 SASI_Hs01_00079568 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028772 predicted 640
2 SASI_Hs01_00028773 predicted 841
3 SASI_Hs01_00028774 predicted 855
4 SASI_Hs01_00028776 predicted 634
5 SASI_Hs01_00028777 predicted 475
6 SASI_Hs02_00308197 predicted 468
7 SASI_Hs01_00028781 predicted 510
8 SASI_Hs02_00308198 predicted 710
9 SASI_Hs02_00308199 predicted 858
10 SASI_Hs02_00308200 predicted 157
11 SASI_Hs01_00028775 predicted 137
12 SASI_Hs01_00028778 predicted 218
13 SASI_Hs01_00028779 predicted 204
14 SASI_Hs01_00028780 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175664 predicted 799
2 SASI_Hs01_00175665 predicted 1009
3 SASI_Hs01_00175666 predicted 52
4 SASI_Hs01_00175667 predicted 160
5 SASI_Hs01_00175669 predicted 800
6 SASI_Hs01_00175670 predicted 630
7 SASI_Hs02_00334882 predicted 631
8 SASI_Hs01_00175673 predicted 184
9 SASI_Hs02_00334883 predicted 73
10 SASI_Hs02_00334884 predicted 670
11 SASI_Hs01_00175668 predicted 303
12 SASI_Hs01_00175671 predicted 378
13 SASI_Hs01_00175672 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091787 predicted 294
2 SASI_Rn01_00091788 predicted 349
3 SASI_Rn02_00198387 predicted 334
4 SASI_Rn01_00091791 predicted 459
5 SASI_Rn01_00091792 predicted 555
6 SASI_Rn01_00091793 predicted 708
7 SASI_Rn01_00091794 predicted 544
8 SASI_Rn02_00198388 predicted 305
9 SASI_Rn01_00091795 predicted 656
10 SASI_Rn01_00091796 predicted 372
11 SASI_Rn01_00091789 predicted 440
12 SASI_Rn01_00091790 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071474 predicted 366
2 SASI_Mm01_00071475 predicted 369
3 SASI_Mm01_00071476 predicted 298
4 SASI_Mm02_00327958 predicted 301
5 SASI_Mm01_00071477 predicted 348
6 SASI_Mm01_00071478 predicted 355
7 SASI_Mm01_00071479 predicted 294
8 SASI_Mm01_00071480 predicted 351
9 SASI_Mm01_00071481 predicted 233
10 SASI_Mm01_00071482 predicted 302
11 SASI_Mm01_00071473 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003001
VALIDATED
SDHC MISSION shRNA Bacterial Glycerol Stock
succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-307s21c1
Sequence:CCGGCCTGGGAACTTTGAGTCTTATCTCGAGATAAGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-87s21c1
Sequence:CCGGCCCTCAGCTCTGTATCAGAAACTCGAGTTTCTGATACAGAGCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003001.3-684s21c1
Sequence:CCGGAGTACCTGGTAGACCATAATACTCGAGTATTATGGTCTACCAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-145s21c1
Sequence:CCGGGAGCGGTTCTGGAATAAGAATCTCGAGATTCTTATTCCAGAACCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-141s1c1
Sequence:CCGGGAGCGGTTCTGGAATAAGAATCTCGAGATTCTTATTCCAGAACCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003001.2-396s1c1
Sequence:CCGGCTCATGTATCATACCTGGAATCTCGAGATTCCAGGTATGATACATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-83s1c1
Sequence:CCGGCCCTCAGCTCTGTATCAGAAACTCGAGTTTCTGATACAGAGCTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-303s1c1
Sequence:CCGGCCTGGGAACTTTGAGTCTTATCTCGAGATAAGACTCAAAGTTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003001
VALIDATED
SDHC MISSION shRNA shRNA Plasmid DNA
succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-307s21c1
Sequence:CCGGCCTGGGAACTTTGAGTCTTATCTCGAGATAAGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-87s21c1
Sequence:CCGGCCCTCAGCTCTGTATCAGAAACTCGAGTTTCTGATACAGAGCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003001.3-684s21c1
Sequence:CCGGAGTACCTGGTAGACCATAATACTCGAGTATTATGGTCTACCAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-145s21c1
Sequence:CCGGGAGCGGTTCTGGAATAAGAATCTCGAGATTCTTATTCCAGAACCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-141s1c1
Sequence:CCGGGAGCGGTTCTGGAATAAGAATCTCGAGATTCTTATTCCAGAACCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003001.2-396s1c1
Sequence:CCGGCTCATGTATCATACCTGGAATCTCGAGATTCCAGGTATGATACATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-83s1c1
Sequence:CCGGCCCTCAGCTCTGTATCAGAAACTCGAGTTTCTGATACAGAGCTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-303s1c1
Sequence:CCGGCCTGGGAACTTTGAGTCTTATCTCGAGATAAGACTCAAAGTTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003001
VALIDATED
SDHC MISSION shRNA Lentiviral Transduction Particles
succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-307s21c1
Sequence:CCGGCCTGGGAACTTTGAGTCTTATCTCGAGATAAGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-87s21c1
Sequence:CCGGCCCTCAGCTCTGTATCAGAAACTCGAGTTTCTGATACAGAGCTGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003001.3-684s21c1
Sequence:CCGGAGTACCTGGTAGACCATAATACTCGAGTATTATGGTCTACCAGGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003001.3-145s21c1
Sequence:CCGGGAGCGGTTCTGGAATAAGAATCTCGAGATTCTTATTCCAGAACCGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-141s1c1
Sequence:CCGGGAGCGGTTCTGGAATAAGAATCTCGAGATTCTTATTCCAGAACCGCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003001.2-396s1c1
Sequence:CCGGCTCATGTATCATACCTGGAATCTCGAGATTCCAGGTATGATACATGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-83s1c1
Sequence:CCGGCCCTCAGCTCTGTATCAGAAACTCGAGTTTCTGATACAGAGCTGAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003001.2-303s1c1
Sequence:CCGGCCTGGGAACTTTGAGTCTTATCTCGAGATAAGACTCAAAGTTCCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025321
VALIDATED
SDHC MISSION shRNA Bacterial Glycerol Stock
succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-369s21c1
Sequence:CCGGCGGCTAAGTTTGTGCTTGTCTCTCGAGAGACAAGCACAAACTTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-371s1c1
Sequence:CCGGCGGCTAAGTTTGTGCTTGTCTCTCGAGAGACAAGCACAAACTTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-186s21c1
Sequence:CCGGCCCATTTGACTATCTACAAATCTCGAGATTTGTAGATAGTCAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025321.3-746s21c1
Sequence:CCGGCGGTTCCACATTTGACTGATTCTCGAGAATCAGTCAAATGTGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-302s21c1
Sequence:CCGGCCTGGGAACTTTGAGTCATATCTCGAGATATGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-748s1c1
Sequence:CCGGCGGTTCCACATTTGACTGATTCTCGAGAATCAGTCAAATGTGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-304s1c1
Sequence:CCGGCCTGGGAACTTTGAGTCATATCTCGAGATATGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025321.1-85s1c1
Sequence:CCGGGCTCAGCGTTGTATCAGAAATCTCGAGATTTCTGATACAACGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-188s1c1
Sequence:CCGGCCCATTTGACTATCTACAAATCTCGAGATTTGTAGATAGTCAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025321
VALIDATED
SDHC MISSION shRNA shRNA Plasmid DNA
succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-369s21c1
Sequence:CCGGCGGCTAAGTTTGTGCTTGTCTCTCGAGAGACAAGCACAAACTTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-371s1c1
Sequence:CCGGCGGCTAAGTTTGTGCTTGTCTCTCGAGAGACAAGCACAAACTTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-186s21c1
Sequence:CCGGCCCATTTGACTATCTACAAATCTCGAGATTTGTAGATAGTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025321.3-746s21c1
Sequence:CCGGCGGTTCCACATTTGACTGATTCTCGAGAATCAGTCAAATGTGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-302s21c1
Sequence:CCGGCCTGGGAACTTTGAGTCATATCTCGAGATATGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-748s1c1
Sequence:CCGGCGGTTCCACATTTGACTGATTCTCGAGAATCAGTCAAATGTGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-304s1c1
Sequence:CCGGCCTGGGAACTTTGAGTCATATCTCGAGATATGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025321.1-85s1c1
Sequence:CCGGGCTCAGCGTTGTATCAGAAATCTCGAGATTTCTGATACAACGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-188s1c1
Sequence:CCGGCCCATTTGACTATCTACAAATCTCGAGATTTGTAGATAGTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025321
VALIDATED
SDHC MISSION shRNA Lentiviral Transduction Particles
succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-369s21c1
Sequence:CCGGCGGCTAAGTTTGTGCTTGTCTCTCGAGAGACAAGCACAAACTTAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-371s1c1
Sequence:CCGGCGGCTAAGTTTGTGCTTGTCTCTCGAGAGACAAGCACAAACTTAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-186s21c1
Sequence:CCGGCCCATTTGACTATCTACAAATCTCGAGATTTGTAGATAGTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025321.3-746s21c1
Sequence:CCGGCGGTTCCACATTTGACTGATTCTCGAGAATCAGTCAAATGTGGAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025321.3-302s21c1
Sequence:CCGGCCTGGGAACTTTGAGTCATATCTCGAGATATGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-748s1c1
Sequence:CCGGCGGTTCCACATTTGACTGATTCTCGAGAATCAGTCAAATGTGGAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-304s1c1
Sequence:CCGGCCTGGGAACTTTGAGTCATATCTCGAGATATGACTCAAAGTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025321.1-85s1c1
Sequence:CCGGGCTCAGCGTTGTATCAGAAATCTCGAGATTTCTGATACAACGCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025321.1-188s1c1
Sequence:CCGGCCCATTTGACTATCTACAAATCTCGAGATTTGTAGATAGTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)