EMAIL THIS PAGE TO A FRIEND

SEC22C

SEC22 vesicle trafficking protein homolog C (S. cerevisiae)

90 Gene Product Result for
Synonyms: SEC22L3
UniProtKB ID: Q9BRL7, O95152, Q68CX3, Q6UW18
Gene ID:
Human(9117) Summary: This gene encodes a member of the SEC22 family of vesicle trafficking proteins. The encoded protein is localized to the endoplasmic reticulum and may play a role in the early stages of ER-Golgi protein trafficking. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(215474) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Zebrafish(558856) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
chicken(420387) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
domestic cat(101096098) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
dog(485615) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
domestic guinea pig(100733161) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
naked mole-rat(101717219) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
cow(614905) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
sheep(101116940) SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004206 Rosetta Predictions human pricing
NM_032970 Rosetta Predictions human pricing
NM_178677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192805 predicted 384
2 SASI_Hs02_00337110 predicted 323
3 SASI_Hs01_00192808 predicted 219
4 SASI_Hs01_00192809 predicted 280
5 SASI_Hs01_00192810 predicted 514
6 SASI_Hs02_00337111 predicted 466
7 SASI_Hs01_00192811 predicted 253
8 SASI_Hs01_00192812 predicted 217
9 SASI_Hs01_00192813 predicted 601
10 SASI_Hs01_00192814 predicted 239
11 SASI_Hs01_00192806 predicted 281
12 SASI_Hs01_00192807 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222616 predicted 385
2 SASI_Hs02_00360598 predicted 325
3 SASI_Hs01_00222619 predicted 215
4 SASI_Hs01_00222620 predicted 271
5 SASI_Hs01_00222621 predicted 515
6 SASI_Hs02_00360599 predicted 475
7 SASI_Hs01_00222622 predicted 249
8 SASI_Hs01_00222623 predicted 222
9 SASI_Hs01_00222624 predicted 600
10 SASI_Hs01_00222625 predicted 231
11 SASI_Hs01_00222617 predicted 281
12 SASI_Hs01_00222618 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349142 predicted 800
2 SASI_Mm02_00349143 predicted 846
3 SASI_Mm02_00349144 predicted 1468
4 SASI_Mm02_00349145 predicted 351
5 SASI_Mm02_00349146 predicted 1370
6 SASI_Mm02_00349147 predicted 1458
7 SASI_Mm02_00349148 predicted 897
8 SASI_Mm02_00349149 predicted 272
9 SASI_Mm02_00349150 predicted 1212
10 SASI_Mm02_00349151 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004206
VALIDATED
SEC22C MISSION shRNA Bacterial Glycerol Stock
SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-644s1c1
Sequence:CCGGGCTCCTAATTTCCGAATGGAACTCGAGTTCCATTCGGAAATTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-278s1c1
Sequence:CCGGGAAGGTTGTGACTTTAGTATACTCGAGTATACTAAAGTCACAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-803s1c1
Sequence:CCGGGTTCCTTTCGTAGCCTGCATTCTCGAGAATGCAGGCTACGAAAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004206.2-735s1c1
Sequence:CCGGGAGTTCACCTTGCAGAACATTCTCGAGAATGTTCTGCAAGGTGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_004206.2-499s1c1
Sequence:CCGGCTATGTAAGTTCCTCTCAGATCTCGAGATCTGAGAGGAACTTACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-740s21c1
Sequence:CCGGCACCTTGCAGAACATTCTTTACTCGAGTAAAGAATGTTCTGCAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-278s21c1
Sequence:CCGGGAAGGTTGTGACTTTAGTATACTCGAGTATACTAAAGTCACAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-169s21c1
Sequence:CCGGCCTCTCAGCCTCTACTGATTTCTCGAGAAATCAGTAGAGGCTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004206.2-1174s21c1
Sequence:CCGGGTGTTATTTCATGAATCATTCCTCGAGGAATGATTCATGAAATAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-634s21c1
Sequence:CCGGCTTGGAGCCTGCTCCTAATTTCTCGAGAAATTAGGAGCAGGCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004206
VALIDATED
SEC22C MISSION shRNA shRNA Plasmid DNA
SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-644s1c1
Sequence:CCGGGCTCCTAATTTCCGAATGGAACTCGAGTTCCATTCGGAAATTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-278s1c1
Sequence:CCGGGAAGGTTGTGACTTTAGTATACTCGAGTATACTAAAGTCACAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-803s1c1
Sequence:CCGGGTTCCTTTCGTAGCCTGCATTCTCGAGAATGCAGGCTACGAAAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004206.2-735s1c1
Sequence:CCGGGAGTTCACCTTGCAGAACATTCTCGAGAATGTTCTGCAAGGTGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_004206.2-499s1c1
Sequence:CCGGCTATGTAAGTTCCTCTCAGATCTCGAGATCTGAGAGGAACTTACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-740s21c1
Sequence:CCGGCACCTTGCAGAACATTCTTTACTCGAGTAAAGAATGTTCTGCAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-278s21c1
Sequence:CCGGGAAGGTTGTGACTTTAGTATACTCGAGTATACTAAAGTCACAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-169s21c1
Sequence:CCGGCCTCTCAGCCTCTACTGATTTCTCGAGAAATCAGTAGAGGCTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004206.2-1174s21c1
Sequence:CCGGGTGTTATTTCATGAATCATTCCTCGAGGAATGATTCATGAAATAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-634s21c1
Sequence:CCGGCTTGGAGCCTGCTCCTAATTTCTCGAGAAATTAGGAGCAGGCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004206
VALIDATED
SEC22C MISSION shRNA Lentiviral Transduction Particles
SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-644s1c1
Sequence:CCGGGCTCCTAATTTCCGAATGGAACTCGAGTTCCATTCGGAAATTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-278s1c1
Sequence:CCGGGAAGGTTGTGACTTTAGTATACTCGAGTATACTAAAGTCACAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004206.2-803s1c1
Sequence:CCGGGTTCCTTTCGTAGCCTGCATTCTCGAGAATGCAGGCTACGAAAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004206.2-735s1c1
Sequence:CCGGGAGTTCACCTTGCAGAACATTCTCGAGAATGTTCTGCAAGGTGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_004206.2-499s1c1
Sequence:CCGGCTATGTAAGTTCCTCTCAGATCTCGAGATCTGAGAGGAACTTACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-740s21c1
Sequence:CCGGCACCTTGCAGAACATTCTTTACTCGAGTAAAGAATGTTCTGCAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-278s21c1
Sequence:CCGGGAAGGTTGTGACTTTAGTATACTCGAGTATACTAAAGTCACAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-169s21c1
Sequence:CCGGCCTCTCAGCCTCTACTGATTTCTCGAGAAATCAGTAGAGGCTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004206.2-1174s21c1
Sequence:CCGGGTGTTATTTCATGAATCATTCCTCGAGGAATGATTCATGAAATAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004206.2-634s21c1
Sequence:CCGGCTTGGAGCCTGCTCCTAATTTCTCGAGAAATTAGGAGCAGGCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178677
VALIDATED
SEC22C MISSION shRNA Bacterial Glycerol Stock
SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-347s1c1
Sequence:CCGGCGGAAAGTTGTGACTTCCTTACTCGAGTAAGGAAGTCACAACTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-816s1c1
Sequence:CCGGCGCAGAGCATTCTTTACAGGTCTCGAGACCTGTAAAGAATGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-514s1c1
Sequence:CCGGCCTTACGCCTTTCTTGAGTTTCTCGAGAAACTCAAGAAAGGCGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-1898s1c1
Sequence:CCGGCCAGGGTTTCAGAGATCCTTACTCGAGTAAGGATCTCTGAAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-817s1c1
Sequence:CCGGGCAGAGCATTCTTTACAGGTTCTCGAGAACCTGTAAAGAATGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178677
VALIDATED
SEC22C MISSION shRNA shRNA Plasmid DNA
SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-347s1c1
Sequence:CCGGCGGAAAGTTGTGACTTCCTTACTCGAGTAAGGAAGTCACAACTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-816s1c1
Sequence:CCGGCGCAGAGCATTCTTTACAGGTCTCGAGACCTGTAAAGAATGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-514s1c1
Sequence:CCGGCCTTACGCCTTTCTTGAGTTTCTCGAGAAACTCAAGAAAGGCGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-1898s1c1
Sequence:CCGGCCAGGGTTTCAGAGATCCTTACTCGAGTAAGGATCTCTGAAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-817s1c1
Sequence:CCGGGCAGAGCATTCTTTACAGGTTCTCGAGAACCTGTAAAGAATGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178677
VALIDATED
SEC22C MISSION shRNA Lentiviral Transduction Particles
SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-347s1c1
Sequence:CCGGCGGAAAGTTGTGACTTCCTTACTCGAGTAAGGAAGTCACAACTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-816s1c1
Sequence:CCGGCGCAGAGCATTCTTTACAGGTCTCGAGACCTGTAAAGAATGCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-514s1c1
Sequence:CCGGCCTTACGCCTTTCTTGAGTTTCTCGAGAAACTCAAGAAAGGCGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-1898s1c1
Sequence:CCGGCCAGGGTTTCAGAGATCCTTACTCGAGTAAGGATCTCTGAAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178677.2-817s1c1
Sequence:CCGGGCAGAGCATTCTTTACAGGTTCTCGAGAACCTGTAAAGAATGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)