EMAIL THIS PAGE TO A FRIEND

SEC24D

SEC24 family, member D (S. cerevisiae)

100 Gene Product Result for
UniProtKB ID: O94855, Q8IYI7
Gene ID:
Human(9871) Summary: The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. [provided by RefSeq, Jul 2008]
Mouse(69608) Sec24 related gene family, member D (S. cerevisiae)
Rat(310843) SEC24 family, member D (S. cerevisiae)
cow(504422) SEC24 family, member D (S. cerevisiae)
sheep(101110591) SEC24 family, member D (S. cerevisiae)
naked mole-rat(101709266) SEC24 family, member D (S. cerevisiae)
domestic guinea pig(100718983) SEC24 family, member D (S. cerevisiae)
Zebrafish(553407) SEC24 family, member D (S. cerevisiae)
Horse(100064058) SEC24 family, member D (S. cerevisiae)
domestic cat(101095976) SEC24 family, member D (S. cerevisiae)
dog(478523) SEC24 family, member D (S. cerevisiae)
chicken(422683) SEC24 family, member D (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014822 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033711 MISSION® esiRNA esiRNA human SEC24D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014822 Rosetta Predictions human pricing
NM_001107723 Rosetta Predictions rat pricing
NM_027135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221199 predicted 2871
2 SASI_Hs01_00221200 predicted 3149
3 SASI_Hs01_00221201 predicted 2632
4 SASI_Hs01_00221202 predicted 2357
5 SASI_Hs01_00221203 predicted 1084
6 SASI_Hs02_00346357 predicted 1159
7 SASI_Hs01_00221204 predicted 1113
8 SASI_Hs02_00346358 predicted 977
9 SASI_Hs01_00221205 predicted 2262
10 SASI_Hs01_00221206 predicted 2455
11 SASI_Hs01_00221198 predicted 2857
12 SASI_Hs01_00221207 predicted 3050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231635 predicted 2919
2 SASI_Rn02_00231636 predicted 2386
3 SASI_Rn02_00231637 predicted 1573
4 SASI_Rn02_00231638 predicted 2881
5 SASI_Rn02_00231639 predicted 1507
6 SASI_Rn02_00231640 predicted 2505
7 SASI_Rn02_00231641 predicted 3014
8 SASI_Rn02_00231642 predicted 2819
9 SASI_Rn02_00231643 predicted 1370
10 SASI_Rn02_00231644 predicted 3047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048313 predicted 1855
2 SASI_Mm01_00048314 predicted 881
3 SASI_Mm01_00048315 predicted 1682
4 SASI_Mm01_00048316 predicted 2847
5 SASI_Mm01_00048317 predicted 2498
6 SASI_Mm02_00331633 predicted 2243
7 SASI_Mm02_00331634 predicted 2435
8 SASI_Mm01_00048319 predicted 2932
9 SASI_Mm01_00048320 predicted 2829
10 SASI_Mm01_00048321 predicted 2522
11 SASI_Mm01_00048318 predicted 2990
12 SASI_Mm01_00048322 predicted 2082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027135
VALIDATED
SEC24D MISSION shRNA Bacterial Glycerol Stock
SEC24 family, member D (S. cerevisiae)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1419s21c1
Sequence:GTACCGGATTGATGTCTCATATAGTAACCTCGAGGTTACTATATGAGACATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-2105s21c1
Sequence:GTACCGGGACCGACCTCCGGAATGATATCTCGAGATATCATTCCGGAGGTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1680s21c1
Sequence:GTACCGGCAATCTGTGATCCACAATTTACTCGAGTAAATTGTGGATCACAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1334s21c1
Sequence:CCGGGTCGCTGGGATCCTATGAATACTCGAGTATTCATAGGATCCCAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-2366s21c1
Sequence:CCGGGATTCACAATCTCGCCTTAAACTCGAGTTTAAGGCGAGATTGTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-913s21c1
Sequence:CCGGCCAGAGGTGGACAAGTCTATACTCGAGTATAGACTTGTCCACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027135.2-3605s21c1
Sequence:CCGGCGTGATGACATTAAACAGAATCTCGAGATTCTGTTTAATGTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-2497s21c1
Sequence:CCGGTCCGGGAAATTCTAGTCAATCCTCGAGGATTGACTAGAATTTCCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1691s1c1
Sequence:CCGGCCACAATTTATTGGACCAGATCTCGAGATCTGGTCCAATAAATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1128s1c1
Sequence:CCGGCCCTTGTACTTGGTAAACCATCTCGAGATGGTTTACCAAGTACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027135.2-2419s1c1
Sequence:CCGGGCTGTGAAACTGATGCCCTTACTCGAGTAAGGGCATCAGTTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027135.2-3605s1c1
Sequence:CCGGCGTGATGACATTAAACAGAATCTCGAGATTCTGTTTAATGTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1692s1c1
Sequence:CCGGCACAATTTATTGGACCAGATTCTCGAGAATCTGGTCCAATAAATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027135
VALIDATED
SEC24D MISSION shRNA shRNA Plasmid DNA
SEC24 family, member D (S. cerevisiae)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1419s21c1
Sequence:GTACCGGATTGATGTCTCATATAGTAACCTCGAGGTTACTATATGAGACATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-2105s21c1
Sequence:GTACCGGGACCGACCTCCGGAATGATATCTCGAGATATCATTCCGGAGGTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1680s21c1
Sequence:GTACCGGCAATCTGTGATCCACAATTTACTCGAGTAAATTGTGGATCACAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1334s21c1
Sequence:CCGGGTCGCTGGGATCCTATGAATACTCGAGTATTCATAGGATCCCAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-2366s21c1
Sequence:CCGGGATTCACAATCTCGCCTTAAACTCGAGTTTAAGGCGAGATTGTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-913s21c1
Sequence:CCGGCCAGAGGTGGACAAGTCTATACTCGAGTATAGACTTGTCCACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027135.2-3605s21c1
Sequence:CCGGCGTGATGACATTAAACAGAATCTCGAGATTCTGTTTAATGTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-2497s21c1
Sequence:CCGGTCCGGGAAATTCTAGTCAATCCTCGAGGATTGACTAGAATTTCCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1691s1c1
Sequence:CCGGCCACAATTTATTGGACCAGATCTCGAGATCTGGTCCAATAAATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1128s1c1
Sequence:CCGGCCCTTGTACTTGGTAAACCATCTCGAGATGGTTTACCAAGTACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027135.2-2419s1c1
Sequence:CCGGGCTGTGAAACTGATGCCCTTACTCGAGTAAGGGCATCAGTTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027135.2-3605s1c1
Sequence:CCGGCGTGATGACATTAAACAGAATCTCGAGATTCTGTTTAATGTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1692s1c1
Sequence:CCGGCACAATTTATTGGACCAGATTCTCGAGAATCTGGTCCAATAAATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027135
VALIDATED
SEC24D MISSION shRNA Lentiviral Transduction Particles
SEC24 family, member D (S. cerevisiae)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1419s21c1
Sequence:GTACCGGATTGATGTCTCATATAGTAACCTCGAGGTTACTATATGAGACATCAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-2105s21c1
Sequence:GTACCGGGACCGACCTCCGGAATGATATCTCGAGATATCATTCCGGAGGTCGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1680s21c1
Sequence:GTACCGGCAATCTGTGATCCACAATTTACTCGAGTAAATTGTGGATCACAGATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027135.2-1334s21c1
Sequence:CCGGGTCGCTGGGATCCTATGAATACTCGAGTATTCATAGGATCCCAGCGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-2366s21c1
Sequence:CCGGGATTCACAATCTCGCCTTAAACTCGAGTTTAAGGCGAGATTGTGAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-913s21c1
Sequence:CCGGCCAGAGGTGGACAAGTCTATACTCGAGTATAGACTTGTCCACCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027135.2-3605s21c1
Sequence:CCGGCGTGATGACATTAAACAGAATCTCGAGATTCTGTTTAATGTCATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027135.2-2497s21c1
Sequence:CCGGTCCGGGAAATTCTAGTCAATCCTCGAGGATTGACTAGAATTTCCCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1691s1c1
Sequence:CCGGCCACAATTTATTGGACCAGATCTCGAGATCTGGTCCAATAAATTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1128s1c1
Sequence:CCGGCCCTTGTACTTGGTAAACCATCTCGAGATGGTTTACCAAGTACAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027135.2-2419s1c1
Sequence:CCGGGCTGTGAAACTGATGCCCTTACTCGAGTAAGGGCATCAGTTTCACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027135.2-3605s1c1
Sequence:CCGGCGTGATGACATTAAACAGAATCTCGAGATTCTGTTTAATGTCATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027135.2-1692s1c1
Sequence:CCGGCACAATTTATTGGACCAGATTCTCGAGAATCTGGTCCAATAAATTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014822
VALIDATED
SEC24D MISSION shRNA Bacterial Glycerol Stock
SEC24 family, member D (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-2685s21c1
Sequence:CCGGATCCGGGAAATTCTAGTTAATCTCGAGATTAACTAGAATTTCCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1865s21c1
Sequence:CCGGATCCCAATCTGTGATTCATAACTCGAGTTATGAATCACAGATTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014822.2-3528s21c1
Sequence:CCGGTCAGGTATAAAGCCAATTAAGCTCGAGCTTAATTGGCTTTATACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1372s21c1
Sequence:CCGGAGGCCTACATGTGCCCATTTACTCGAGTAAATGGGCACATGTAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014822.1-1383s1c1
Sequence:CCGGCCACCATTCTATTTCCAACATCTCGAGATGTTGGAAATAGAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1518s21c1
Sequence:CCGGGAGTTATCTCTAGGATCTTATCTCGAGATAAGATCCTAGAGATAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2481s1c1
Sequence:CCGGCGGATTCACAATCTTGGCTTACTCGAGTAAGCCAAGATTGTGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2198s1c1
Sequence:CCGGGCACTTGGATAGACAACAATTCTCGAGAATTGTTGTCTATCCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-1096s1c1
Sequence:CCGGGCATGATACAAGACCAAGGAACTCGAGTTCCTTGGTCTTGTATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2932s1c1
Sequence:CCGGCCCGTCTTTCAGAAGAAGGAACTCGAGTTCCTTCTTCTGAAAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014822
VALIDATED
SEC24D MISSION shRNA shRNA Plasmid DNA
SEC24 family, member D (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-2685s21c1
Sequence:CCGGATCCGGGAAATTCTAGTTAATCTCGAGATTAACTAGAATTTCCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1865s21c1
Sequence:CCGGATCCCAATCTGTGATTCATAACTCGAGTTATGAATCACAGATTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014822.2-3528s21c1
Sequence:CCGGTCAGGTATAAAGCCAATTAAGCTCGAGCTTAATTGGCTTTATACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1372s21c1
Sequence:CCGGAGGCCTACATGTGCCCATTTACTCGAGTAAATGGGCACATGTAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014822.1-1383s1c1
Sequence:CCGGCCACCATTCTATTTCCAACATCTCGAGATGTTGGAAATAGAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1518s21c1
Sequence:CCGGGAGTTATCTCTAGGATCTTATCTCGAGATAAGATCCTAGAGATAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2481s1c1
Sequence:CCGGCGGATTCACAATCTTGGCTTACTCGAGTAAGCCAAGATTGTGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2198s1c1
Sequence:CCGGGCACTTGGATAGACAACAATTCTCGAGAATTGTTGTCTATCCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-1096s1c1
Sequence:CCGGGCATGATACAAGACCAAGGAACTCGAGTTCCTTGGTCTTGTATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2932s1c1
Sequence:CCGGCCCGTCTTTCAGAAGAAGGAACTCGAGTTCCTTCTTCTGAAAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014822
VALIDATED
SEC24D MISSION shRNA Lentiviral Transduction Particles
SEC24 family, member D (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-2685s21c1
Sequence:CCGGATCCGGGAAATTCTAGTTAATCTCGAGATTAACTAGAATTTCCCGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1865s21c1
Sequence:CCGGATCCCAATCTGTGATTCATAACTCGAGTTATGAATCACAGATTGGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014822.2-3528s21c1
Sequence:CCGGTCAGGTATAAAGCCAATTAAGCTCGAGCTTAATTGGCTTTATACCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1372s21c1
Sequence:CCGGAGGCCTACATGTGCCCATTTACTCGAGTAAATGGGCACATGTAGGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014822.1-1383s1c1
Sequence:CCGGCCACCATTCTATTTCCAACATCTCGAGATGTTGGAAATAGAATGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014822.2-1518s21c1
Sequence:CCGGGAGTTATCTCTAGGATCTTATCTCGAGATAAGATCCTAGAGATAACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2481s1c1
Sequence:CCGGCGGATTCACAATCTTGGCTTACTCGAGTAAGCCAAGATTGTGAATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2198s1c1
Sequence:CCGGGCACTTGGATAGACAACAATTCTCGAGAATTGTTGTCTATCCAAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-1096s1c1
Sequence:CCGGGCATGATACAAGACCAAGGAACTCGAGTTCCTTGGTCTTGTATCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014822.1-2932s1c1
Sequence:CCGGCCCGTCTTTCAGAAGAAGGAACTCGAGTTCCTTCTTCTGAAAGACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)