EMAIL THIS PAGE TO A FRIEND

SEC31B

SEC31 homolog B (S. cerevisiae)

64 Gene Product Result for
Synonyms: SEC31B-1 SEC31L2
UniProtKB ID: Q9NQW1, B7ZM75, Q6MZS3, Q86UF0, Q9Y4Q8
Gene ID:
Human(25956) Summary: This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Mouse(240667) Sec31 homolog B (S. cerevisiae)
Rat(309433) SEC31 homolog B (S. cerevisiae)
cow(507880) SEC31 homolog B (S. cerevisiae)
sheep(101111678) SEC31 homolog B (S. cerevisiae)
Domestic Rabbit(100358193) SEC31 homolog B (S. cerevisiae)
domestic guinea pig(100724123) SEC31 homolog B (S. cerevisiae)
Zebrafish(100148383) Sec31 homolog B (S. cerevisiae)
Horse(100070349) SEC31 homolog B (S. cerevisiae)
domestic cat(101096608) SEC31 homolog B (S. cerevisiae)
dog(486842) SEC31 homolog B (S. cerevisiae)
chicken(423764) SEC31 homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015490 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015490 Rosetta Predictions human pricing
XM_001057433 Rosetta Predictions rat pricing
XM_219960 Rosetta Predictions rat pricing
NM_001033343 Rosetta Predictions mouse pricing
XM_140784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200497 predicted 2765
2 SASI_Hs01_00200498 predicted 1421
3 SASI_Hs01_00200499 predicted 214
4 SASI_Hs01_00200500 predicted 1135
5 SASI_Hs02_00347952 predicted 531
6 SASI_Hs01_00200501 predicted 782
7 SASI_Hs01_00200502 predicted 377
8 SASI_Hs01_00200503 predicted 2409
9 SASI_Hs01_00200504 predicted 688
10 SASI_Hs01_00200505 predicted 3343
11 SASI_Hs01_00200506 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286319 predicted 207
2 SASI_Rn02_00286320 predicted 1944
3 SASI_Rn02_00286321 predicted 588
4 SASI_Rn02_00286322 predicted 1512
5 SASI_Rn02_00286323 predicted 2770
6 SASI_Rn02_00286324 predicted 3321
7 SASI_Rn02_00286325 predicted 743
8 SASI_Rn02_00286326 predicted 361
9 SASI_Rn02_00286327 predicted 1199
10 SASI_Rn02_00286328 predicted 2757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378875 predicted 2514
2 SASI_Rn02_00378876 predicted 207
3 SASI_Rn02_00378877 predicted 584
4 SASI_Rn02_00378878 predicted 2774
5 SASI_Rn02_00378879 predicted 3321
6 SASI_Rn02_00378880 predicted 676
7 SASI_Rn02_00378881 predicted 745
8 SASI_Rn02_00378882 predicted 365
9 SASI_Rn02_00378883 predicted 1193
10 SASI_Rn02_00378884 predicted 2755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288597 predicted 1908
2 SASI_Mm02_00288598 predicted 1722
3 SASI_Mm02_00288599 predicted 421
4 SASI_Mm02_00288600 predicted 524
5 SASI_Mm02_00288601 predicted 688
6 SASI_Mm02_00288602 predicted 600
7 SASI_Mm02_00288603 predicted 254
8 SASI_Mm02_00288604 predicted 1485
9 SASI_Mm02_00288605 predicted 1158
10 SASI_Mm02_00288606 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244685 predicted 1963
2 SASI_Mm01_00244686 predicted 1778
3 SASI_Mm01_00244687 predicted 429
4 SASI_Mm01_00244688 predicted 2004
5 SASI_Mm01_00244689 predicted 530
6 SASI_Mm01_00244690 predicted 685
7 SASI_Mm01_00244691 predicted 601
8 SASI_Mm01_00244692 predicted 258
9 SASI_Mm01_00244693 predicted 1208
10 SASI_Mm01_00244694 predicted 2415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033343
SEC31B MISSION shRNA Bacterial Glycerol Stock
SEC31 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-1064s21c1
Sequence:CCGGTTCGATGGCTGGATCAGTTTGCTCGAGCAAACTGATCCAGCCATCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-3070s21c1
Sequence:CCGGCATGCCTCCAGCACCAATTACCTCGAGGTAATTGGTGCTGGAGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033343.1-3597s21c1
Sequence:CCGGCCGCCTCTGCTGTTACTTAACCTCGAGGTTAAGTAACAGCAGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-373s21c1
Sequence:CCGGCAACGGCACACTGACTCTATACTCGAGTATAGAGTCAGTGTGCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-1936s21c1
Sequence:CCGGGAATTGGAAGGACCTAGTATGCTCGAGCATACTAGGTCCTTCCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033343
SEC31B MISSION shRNA shRNA Plasmid DNA
SEC31 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-1064s21c1
Sequence:CCGGTTCGATGGCTGGATCAGTTTGCTCGAGCAAACTGATCCAGCCATCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-3070s21c1
Sequence:CCGGCATGCCTCCAGCACCAATTACCTCGAGGTAATTGGTGCTGGAGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033343.1-3597s21c1
Sequence:CCGGCCGCCTCTGCTGTTACTTAACCTCGAGGTTAAGTAACAGCAGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-373s21c1
Sequence:CCGGCAACGGCACACTGACTCTATACTCGAGTATAGAGTCAGTGTGCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-1936s21c1
Sequence:CCGGGAATTGGAAGGACCTAGTATGCTCGAGCATACTAGGTCCTTCCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033343
SEC31B MISSION shRNA Lentiviral Transduction Particles
SEC31 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-1064s21c1
Sequence:CCGGTTCGATGGCTGGATCAGTTTGCTCGAGCAAACTGATCCAGCCATCGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-3070s21c1
Sequence:CCGGCATGCCTCCAGCACCAATTACCTCGAGGTAATTGGTGCTGGAGGCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033343.1-3597s21c1
Sequence:CCGGCCGCCTCTGCTGTTACTTAACCTCGAGGTTAAGTAACAGCAGAGGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-373s21c1
Sequence:CCGGCAACGGCACACTGACTCTATACTCGAGTATAGAGTCAGTGTGCCGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033343.1-1936s21c1
Sequence:CCGGGAATTGGAAGGACCTAGTATGCTCGAGCATACTAGGTCCTTCCAATTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015490
SEC31B MISSION shRNA Bacterial Glycerol Stock
SEC31 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-709s1c1
Sequence:CCGGCCTATCATCAAAGTCAGTGATCTCGAGATCACTGACTTTGATGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-1083s1c1
Sequence:CCGGGATCAGTTTGTACTCTGTGATCTCGAGATCACAGAGTACAAACTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-524s1c1
Sequence:CCGGCCAGCGATTCTGAAATCTTCACTCGAGTGAAGATTTCAGAATCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015490.3-4398s1c1
Sequence:CCGGGCCATTCCTTCTGTGATGATACTCGAGTATCATCACAGAAGGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015490.3-4234s21c1
Sequence:CCGGTCTCATCTGCCGGCATTATTACTCGAGTAATAATGCCGGCAGATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-3609s21c1
Sequence:CCGGTGTCCTCATCATCGCTCATAACTCGAGTTATGAGCGATGATGAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-974s21c1
Sequence:CCGGGGAGCAGTGAGGTGGTATATACTCGAGTATATACCACCTCACTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-1243s1c1
Sequence:CCGGCCCAAATGGATTAGAAGACCACTCGAGTGGTCTTCTAATCCATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015490.3-4399s1c1
Sequence:CCGGCCATTCCTTCTGTGATGATAACTCGAGTTATCATCACAGAAGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-2756s21c1
Sequence:CCGGCATCTCAGCCACAGCTATTAGCTCGAGCTAATAGCTGTGGCTGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-3420s21c1
Sequence:CCGGCCAGCGTCTGGAGTATCTATACTCGAGTATAGATACTCCAGACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015490
SEC31B MISSION shRNA shRNA Plasmid DNA
SEC31 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-709s1c1
Sequence:CCGGCCTATCATCAAAGTCAGTGATCTCGAGATCACTGACTTTGATGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-1083s1c1
Sequence:CCGGGATCAGTTTGTACTCTGTGATCTCGAGATCACAGAGTACAAACTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-524s1c1
Sequence:CCGGCCAGCGATTCTGAAATCTTCACTCGAGTGAAGATTTCAGAATCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015490.3-4398s1c1
Sequence:CCGGGCCATTCCTTCTGTGATGATACTCGAGTATCATCACAGAAGGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015490.3-4234s21c1
Sequence:CCGGTCTCATCTGCCGGCATTATTACTCGAGTAATAATGCCGGCAGATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-3609s21c1
Sequence:CCGGTGTCCTCATCATCGCTCATAACTCGAGTTATGAGCGATGATGAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-974s21c1
Sequence:CCGGGGAGCAGTGAGGTGGTATATACTCGAGTATATACCACCTCACTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-1243s1c1
Sequence:CCGGCCCAAATGGATTAGAAGACCACTCGAGTGGTCTTCTAATCCATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015490.3-4399s1c1
Sequence:CCGGCCATTCCTTCTGTGATGATAACTCGAGTTATCATCACAGAAGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-2756s21c1
Sequence:CCGGCATCTCAGCCACAGCTATTAGCTCGAGCTAATAGCTGTGGCTGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-3420s21c1
Sequence:CCGGCCAGCGTCTGGAGTATCTATACTCGAGTATAGATACTCCAGACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015490
SEC31B MISSION shRNA Lentiviral Transduction Particles
SEC31 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-709s1c1
Sequence:CCGGCCTATCATCAAAGTCAGTGATCTCGAGATCACTGACTTTGATGATAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000147282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-1083s1c1
Sequence:CCGGGATCAGTTTGTACTCTGTGATCTCGAGATCACAGAGTACAAACTGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000148627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-524s1c1
Sequence:CCGGCCAGCGATTCTGAAATCTTCACTCGAGTGAAGATTTCAGAATCGCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015490.3-4398s1c1
Sequence:CCGGGCCATTCCTTCTGTGATGATACTCGAGTATCATCACAGAAGGAATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000232791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015490.3-4234s21c1
Sequence:CCGGTCTCATCTGCCGGCATTATTACTCGAGTAATAATGCCGGCAGATGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000232790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-3609s21c1
Sequence:CCGGTGTCCTCATCATCGCTCATAACTCGAGTTATGAGCGATGATGAGGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000232787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-974s21c1
Sequence:CCGGGGAGCAGTGAGGTGGTATATACTCGAGTATATACCACCTCACTGCTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015490.3-1243s1c1
Sequence:CCGGCCCAAATGGATTAGAAGACCACTCGAGTGGTCTTCTAATCCATTTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000147107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015490.3-4399s1c1
Sequence:CCGGCCATTCCTTCTGTGATGATAACTCGAGTTATCATCACAGAAGGAATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000232788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-2756s21c1
Sequence:CCGGCATCTCAGCCACAGCTATTAGCTCGAGCTAATAGCTGTGGCTGAGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000232789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015490.3-3420s21c1
Sequence:CCGGCCAGCGTCTGGAGTATCTATACTCGAGTATAGATACTCCAGACGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???