EMAIL THIS PAGE TO A FRIEND

SEH1L

SEH1-like (S. cerevisiae)

174 Gene Product Result for
Synonyms: SEC13L SEH1A SEH1B Seh1
UniProtKB ID: Q96EE3, A8K5B1, Q8NFU6, Q96MH3, Q9C069
Gene ID:
Human(81929) Summary: The protein encoded by this gene is part of a nuclear pore complex, Nup107-160. This protein contains WD repeats and shares 34% amino acid identity with yeast Seh1 and 30% identity with yeast Sec13. All constituents of the Nup107-160 complex, including this protein, specifically localize to kinetochores in mitosis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(72124) SEH1-like (S. cerevisiae
Rat(307347) SEH1-like (S. cerevisiae)
Zebrafish(334749) SEH1-like (S. cerevisiae)
domestic cat(101094793) SEH1-like (S. cerevisiae)
dog(490564) SEH1-like (S. cerevisiae)
chicken(100859886) SEH1-like (S. cerevisiae)
cow(506509) SEH1-like (S. cerevisiae)
sheep(101107244) SEH1-like (S. cerevisiae)
domestic guinea pig(100731812) SEH1-like (S. cerevisiae)
naked mole-rat(101726416) SEH1-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031216 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013437 Rosetta Predictions human pricing
NM_031216 Rosetta Predictions human pricing
XM_225856 Rosetta Predictions rat pricing
XR_005455 Rosetta Predictions rat pricing
XR_009618 Rosetta Predictions rat pricing
XR_009619 Rosetta Predictions rat pricing
NM_001039088 Rosetta Predictions mouse pricing
NM_028112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018664 predicted 949
2 SASI_Hs01_00018665 predicted 619
3 SASI_Hs01_00018666 predicted 948
4 SASI_Hs01_00018668 predicted 875
5 SASI_Hs01_00018669 predicted 255
6 SASI_Hs01_00018670 predicted 543
7 SASI_Hs01_00018671 predicted 468
8 SASI_Hs01_00018673 predicted 477
9 SASI_Hs02_00306374 predicted 628
10 SASI_Hs02_00306375 predicted 840
11 SASI_Hs01_00018667 predicted 473
12 SASI_Hs01_00018672 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218199 predicted 948
2 SASI_Hs01_00218200 predicted 624
3 SASI_Hs01_00218201 predicted 953
4 SASI_Hs01_00218203 predicted 875
5 SASI_Hs01_00218204 predicted 256
6 SASI_Hs01_00218205 predicted 538
7 SASI_Hs01_00218206 predicted 470
8 SASI_Hs01_00218208 predicted 477
9 SASI_Hs02_00358631 predicted 630
10 SASI_Hs02_00358632 predicted 841
11 SASI_Hs01_00218202 predicted 475
12 SASI_Hs01_00218207 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140422 predicted 6409
2 SASI_Rn01_00140423 predicted 6354
3 SASI_Rn01_00140424 predicted 4638
4 SASI_Rn01_00140425 predicted 6000
5 SASI_Rn01_00140426 predicted 5192
6 SASI_Rn01_00140427 predicted 5456
7 SASI_Rn01_00140428 predicted 3925
8 SASI_Rn01_00140429 predicted 5380
9 SASI_Rn01_00140430 predicted 7117
10 SASI_Rn01_00140431 predicted 7250
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409327 predicted 1300
2 SASI_Rn02_00409328 predicted 6956
3 SASI_Rn02_00409329 predicted 5888
4 SASI_Rn02_00409330 predicted 2828
5 SASI_Rn02_00409331 predicted 7571
6 SASI_Rn02_00409332 predicted 8997
7 SASI_Rn02_00409333 predicted 885
8 SASI_Rn02_00409334 predicted 4679
9 SASI_Rn02_00409335 predicted 4941
10 SASI_Rn02_00409336 predicted 3436
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420355 predicted 1305
2 SASI_Rn02_00420356 predicted 6958
3 SASI_Rn02_00420357 predicted 5889
4 SASI_Rn02_00420358 predicted 2833
5 SASI_Rn02_00420359 predicted 7571
6 SASI_Rn02_00420360 predicted 9001
7 SASI_Rn02_00420361 predicted 877
8 SASI_Rn02_00420362 predicted 4685
9 SASI_Rn02_00420363 predicted 4932
10 SASI_Rn02_00420364 predicted 3437
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420365 predicted 1304
2 SASI_Rn02_00420366 predicted 6962
3 SASI_Rn02_00420367 predicted 5888
4 SASI_Rn02_00420368 predicted 2831
5 SASI_Rn02_00420369 predicted 7576
6 SASI_Rn02_00420370 predicted 9004
7 SASI_Rn02_00420371 predicted 879
8 SASI_Rn02_00420372 predicted 4675
9 SASI_Rn02_00420373 predicted 4938
10 SASI_Rn02_00420374 predicted 3440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139477 predicted 325
2 SASI_Mm02_00289777 predicted 280
3 SASI_Mm01_00139479 predicted 238
4 SASI_Mm01_00139480 predicted 483
5 SASI_Mm01_00139481 predicted 614
6 SASI_Mm01_00139482 predicted 695
7 SASI_Mm01_00139483 predicted 494
8 SASI_Mm01_00139484 predicted 286
9 SASI_Mm01_00139485 predicted 854
10 SASI_Mm01_00139486 predicted 796
11 SASI_Mm01_00139478 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129198 predicted 326
2 SASI_Mm02_00333361 predicted 279
3 SASI_Mm01_00129200 predicted 238
4 SASI_Mm01_00129201 predicted 488
5 SASI_Mm01_00129202 predicted 620
6 SASI_Mm01_00129203 predicted 686
7 SASI_Mm01_00129204 predicted 496
8 SASI_Mm01_00129205 predicted 281
9 SASI_Mm01_00129206 predicted 854
10 SASI_Mm01_00129207 predicted 802
11 SASI_Mm01_00129199 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028112
VALIDATED
SEH1L MISSION shRNA Bacterial Glycerol Stock
SEH1-like (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028112.2-1547s21c1
Sequence:CCGGTTAGTGGCTTCCTTGGTTATACTCGAGTATAACCAAGGAAGCCACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-475s21c1
Sequence:CCGGCCTCTGTTACTGATGTGAAATCTCGAGATTTCACATCAGTAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028112.2-1448s21c1
Sequence:CCGGTCTCCTGGTAGTCATACTAAACTCGAGTTTAGTATGACTACCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-1095s21c1
Sequence:CCGGGGTAACGGGAGCCCAGTAAATCTCGAGATTTACTGGGCTCCCGTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-691s21c1
Sequence:CCGGGTGATGATAGCAGTCCAAATTCTCGAGAATTTGGACTGCTATCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-855s21c1
Sequence:CCGGGCAACCAAAGATGTAAGAATTCTCGAGAATTCTTACATCTTTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028112.1-1401s1c1
Sequence:CCGGCACCAATAATTGTGACACTTACTCGAGTAAGTGTCACAATTATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028112.1-84s1c1
Sequence:CCGGCGATGTGTCTTTCGACTTCCACTCGAGTGGAAGTCGAAAGACACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028112.1-757s1c1
Sequence:CCGGGCAACCAAAGATGTAAGAATTCTCGAGAATTCTTACATCTTTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028112.1-81s1c1
Sequence:CCGGCCACGATGTGTCTTTCGACTTCTCGAGAAGTCGAAAGACACATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028112.1-377s1c1
Sequence:CCGGCCTCTGTTACTGATGTGAAATCTCGAGATTTCACATCAGTAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028112
VALIDATED
SEH1L MISSION shRNA shRNA Plasmid DNA
SEH1-like (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028112.2-1547s21c1
Sequence:CCGGTTAGTGGCTTCCTTGGTTATACTCGAGTATAACCAAGGAAGCCACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-475s21c1
Sequence:CCGGCCTCTGTTACTGATGTGAAATCTCGAGATTTCACATCAGTAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028112.2-1448s21c1
Sequence:CCGGTCTCCTGGTAGTCATACTAAACTCGAGTTTAGTATGACTACCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-1095s21c1
Sequence:CCGGGGTAACGGGAGCCCAGTAAATCTCGAGATTTACTGGGCTCCCGTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-691s21c1
Sequence:CCGGGTGATGATAGCAGTCCAAATTCTCGAGAATTTGGACTGCTATCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-855s21c1
Sequence:CCGGGCAACCAAAGATGTAAGAATTCTCGAGAATTCTTACATCTTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028112.1-1401s1c1
Sequence:CCGGCACCAATAATTGTGACACTTACTCGAGTAAGTGTCACAATTATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028112.1-84s1c1
Sequence:CCGGCGATGTGTCTTTCGACTTCCACTCGAGTGGAAGTCGAAAGACACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028112.1-757s1c1
Sequence:CCGGGCAACCAAAGATGTAAGAATTCTCGAGAATTCTTACATCTTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028112.1-81s1c1
Sequence:CCGGCCACGATGTGTCTTTCGACTTCTCGAGAAGTCGAAAGACACATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028112.1-377s1c1
Sequence:CCGGCCTCTGTTACTGATGTGAAATCTCGAGATTTCACATCAGTAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028112
VALIDATED
SEH1L MISSION shRNA Lentiviral Transduction Particles
SEH1-like (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028112.2-1547s21c1
Sequence:CCGGTTAGTGGCTTCCTTGGTTATACTCGAGTATAACCAAGGAAGCCACTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-475s21c1
Sequence:CCGGCCTCTGTTACTGATGTGAAATCTCGAGATTTCACATCAGTAACAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028112.2-1448s21c1
Sequence:CCGGTCTCCTGGTAGTCATACTAAACTCGAGTTTAGTATGACTACCAGGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-1095s21c1
Sequence:CCGGGGTAACGGGAGCCCAGTAAATCTCGAGATTTACTGGGCTCCCGTTACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-691s21c1
Sequence:CCGGGTGATGATAGCAGTCCAAATTCTCGAGAATTTGGACTGCTATCATCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028112.2-855s21c1
Sequence:CCGGGCAACCAAAGATGTAAGAATTCTCGAGAATTCTTACATCTTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028112.1-1401s1c1
Sequence:CCGGCACCAATAATTGTGACACTTACTCGAGTAAGTGTCACAATTATTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028112.1-84s1c1
Sequence:CCGGCGATGTGTCTTTCGACTTCCACTCGAGTGGAAGTCGAAAGACACATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028112.1-757s1c1
Sequence:CCGGGCAACCAAAGATGTAAGAATTCTCGAGAATTCTTACATCTTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028112.1-81s1c1
Sequence:CCGGCCACGATGTGTCTTTCGACTTCTCGAGAAGTCGAAAGACACATCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028112.1-377s1c1
Sequence:CCGGCCTCTGTTACTGATGTGAAATCTCGAGATTTCACATCAGTAACAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031216
VALIDATED
SEH1L MISSION shRNA Bacterial Glycerol Stock
SEH1-like (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-585s1c1
Sequence:CCGGCATGTAAGCTAAGCTGTAGTTCTCGAGAACTACAGCTTAGCTTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-508s1c1
Sequence:CCGGCGCAGATGGTATAGTAAGAATCTCGAGATTCTTACTATACCATCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-946s21c1
Sequence:CCGGATAGTGGCTCAGTTCGATAATCTCGAGATTATCGAACTGAGCCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-982s21c1
Sequence:CCGGTGGCGAGTGAGTTGGAATATACTCGAGTATATTCCAACTCACTCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-540s21c1
Sequence:CCGGCGCAGATGGTATAGTAAGAATCTCGAGATTCTTACTATACCATCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-654s1c1
Sequence:CCGGCCGTAGGAAGTGATGACAGTACTCGAGTACTGTCATCACTTCCTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-617s21c1
Sequence:CCGGCATGTAAGCTAAGCTGTAGTTCTCGAGAACTACAGCTTAGCTTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-606s1c1
Sequence:CCGGGCATTTCTTGGAACCCTTCAACTCGAGTTGAAGGGTTCCAAGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031216
VALIDATED
SEH1L MISSION shRNA shRNA Plasmid DNA
SEH1-like (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-585s1c1
Sequence:CCGGCATGTAAGCTAAGCTGTAGTTCTCGAGAACTACAGCTTAGCTTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-508s1c1
Sequence:CCGGCGCAGATGGTATAGTAAGAATCTCGAGATTCTTACTATACCATCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-946s21c1
Sequence:CCGGATAGTGGCTCAGTTCGATAATCTCGAGATTATCGAACTGAGCCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-982s21c1
Sequence:CCGGTGGCGAGTGAGTTGGAATATACTCGAGTATATTCCAACTCACTCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-540s21c1
Sequence:CCGGCGCAGATGGTATAGTAAGAATCTCGAGATTCTTACTATACCATCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-654s1c1
Sequence:CCGGCCGTAGGAAGTGATGACAGTACTCGAGTACTGTCATCACTTCCTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-617s21c1
Sequence:CCGGCATGTAAGCTAAGCTGTAGTTCTCGAGAACTACAGCTTAGCTTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-606s1c1
Sequence:CCGGGCATTTCTTGGAACCCTTCAACTCGAGTTGAAGGGTTCCAAGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031216
VALIDATED
SEH1L MISSION shRNA Lentiviral Transduction Particles
SEH1-like (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-585s1c1
Sequence:CCGGCATGTAAGCTAAGCTGTAGTTCTCGAGAACTACAGCTTAGCTTACATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-508s1c1
Sequence:CCGGCGCAGATGGTATAGTAAGAATCTCGAGATTCTTACTATACCATCTGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-946s21c1
Sequence:CCGGATAGTGGCTCAGTTCGATAATCTCGAGATTATCGAACTGAGCCACTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-982s21c1
Sequence:CCGGTGGCGAGTGAGTTGGAATATACTCGAGTATATTCCAACTCACTCGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-540s21c1
Sequence:CCGGCGCAGATGGTATAGTAAGAATCTCGAGATTCTTACTATACCATCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-654s1c1
Sequence:CCGGCCGTAGGAAGTGATGACAGTACTCGAGTACTGTCATCACTTCCTACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031216.3-617s21c1
Sequence:CCGGCATGTAAGCTAAGCTGTAGTTCTCGAGAACTACAGCTTAGCTTACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031216.2-606s1c1
Sequence:CCGGGCATTTCTTGGAACCCTTCAACTCGAGTTGAAGGGTTCCAAGAAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)