EMAIL THIS PAGE TO A FRIEND

SELE

selectin E

54 Gene Product Result for
Synonyms: CD62E ELAM ELAM1 ESEL LECAM2
UniProtKB ID: P16581, A2RRD6, P16111
Gene ID:
Human(6401) Summary: The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
Mouse(20339) selectin, endothelial cell
Rat(25544) selectin E
Zebrafish(558139) selectin E
chicken(424402) selectin E (endothelial adhesion molecule 1)
Horse(100033910) selectin E
dog(403999) selectin E
cow(281484) selectin E
sheep(443127) selectin E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S9555 Anti-E-Selectin (CD62E) antibody, Mouse monoclonal clone 1.2B6, purified from hybridoma cell culture pig, human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1406422 Anti-SELE antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025421 MISSION® esiRNA targeting human SELE human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000450 Rosetta Predictions human pricing
NM_138879 Rosetta Predictions rat pricing
NM_011345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302571 predicted 877
2 SASI_Hs01_00157171 predicted 339
3 SASI_Hs01_00157172 predicted 2051
4 SASI_Hs02_00302572 predicted 821
5 SASI_Hs01_00157173 predicted 1704
6 SASI_Hs01_00157174 predicted 335
7 SASI_Hs01_00157175 predicted 265
8 SASI_Hs01_00157176 predicted 757
9 SASI_Hs01_00157177 predicted 1494
10 SASI_Hs01_00157178 predicted 1867
11 SASI_Hs01_00157179 predicted 568
12 SASI_Hs01_00157180 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268307 predicted 1284
2 SASI_Rn01_00033045 predicted 1598
3 SASI_Rn01_00033046 predicted 800
4 SASI_Rn01_00033047 predicted 980
5 SASI_Rn01_00033048 predicted 1128
6 SASI_Rn01_00033050 predicted 757
7 SASI_Rn02_00268308 predicted 332
8 SASI_Rn01_00033051 predicted 1167
9 SASI_Rn01_00033052 predicted 1571
10 SASI_Rn01_00033054 predicted 826
11 SASI_Rn01_00033049 predicted 1521
12 SASI_Rn01_00033053 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320484 predicted 260
2 SASI_Mm01_00029291 predicted 1109
3 SASI_Mm01_00029292 predicted 692
4 SASI_Mm01_00029293 predicted 1206
5 SASI_Mm01_00029294 predicted 1961
6 SASI_Mm02_00320485 predicted 941
7 SASI_Mm01_00029296 predicted 1103
8 SASI_Mm02_00320486 predicted 505
9 SASI_Mm01_00029297 predicted 301
10 SASI_Mm01_00029298 predicted 980
11 SASI_Mm01_00029290 predicted 990
12 SASI_Mm01_00029295 predicted 274
13 SASI_Mm01_00029299 predicted 1857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000450
SELE MISSION shRNA Bacterial Glycerol Stock
selectin E
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000450.2-2310s21c1
Sequence:CCGGCTCTCCCTTGCTCGCTGTAAACTCGAGTTTACAGCGAGCAAGGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-846s1c1
Sequence:CCGGGCTGTGACAAATCCAGCCAATCTCGAGATTGGCTGGATTTGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-1239s1c1
Sequence:CCGGCGAGGCTACATGAATTGTCTTCTCGAGAAGACAATTCATGTAGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-1817s1c1
Sequence:CCGGCCTCCTGACATTAGCACCATTCTCGAGAATGGTGCTAATGTCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-637s1c1
Sequence:CCGGGTGAGCAAATTGTGAACTGTACTCGAGTACAGTTCACAATTTGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-222s1c1
Sequence:CCGGGCCAGTGCTTATTGTCAGCAACTCGAGTTGCTGACAATAAGCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000450
SELE MISSION shRNA shRNA Plasmid DNA
selectin E
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000450.2-2310s21c1
Sequence:CCGGCTCTCCCTTGCTCGCTGTAAACTCGAGTTTACAGCGAGCAAGGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-846s1c1
Sequence:CCGGGCTGTGACAAATCCAGCCAATCTCGAGATTGGCTGGATTTGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-1239s1c1
Sequence:CCGGCGAGGCTACATGAATTGTCTTCTCGAGAAGACAATTCATGTAGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-1817s1c1
Sequence:CCGGCCTCCTGACATTAGCACCATTCTCGAGAATGGTGCTAATGTCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-637s1c1
Sequence:CCGGGTGAGCAAATTGTGAACTGTACTCGAGTACAGTTCACAATTTGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-222s1c1
Sequence:CCGGGCCAGTGCTTATTGTCAGCAACTCGAGTTGCTGACAATAAGCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000450
SELE MISSION shRNA Lentiviral Transduction Particles
selectin E
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000450.2-2310s21c1
Sequence:CCGGCTCTCCCTTGCTCGCTGTAAACTCGAGTTTACAGCGAGCAAGGGAGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-846s1c1
Sequence:CCGGGCTGTGACAAATCCAGCCAATCTCGAGATTGGCTGGATTTGTCACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-1239s1c1
Sequence:CCGGCGAGGCTACATGAATTGTCTTCTCGAGAAGACAATTCATGTAGCCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-1817s1c1
Sequence:CCGGCCTCCTGACATTAGCACCATTCTCGAGAATGGTGCTAATGTCAGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-637s1c1
Sequence:CCGGGTGAGCAAATTGTGAACTGTACTCGAGTACAGTTCACAATTTGCTCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000450.1-222s1c1
Sequence:CCGGGCCAGTGCTTATTGTCAGCAACTCGAGTTGCTGACAATAAGCACTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011345
SELE MISSION shRNA Bacterial Glycerol Stock
selectin E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-307s1c1
Sequence:CCGGCTACCTTAACTCCAATCTGAACTCGAGTTCAGATTGGAGTTAAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-504s1c1
Sequence:CCGGGCATGTGGAATGACGAGAGATCTCGAGATCTCTCGTCATTCCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-885s1c1
Sequence:CCGGCCCACGGTATCAGGAAATGTTCTCGAGAACATTTCCTGATACCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-1861s1c1
Sequence:CCGGGCTCTACTTGTTGATGAGATACTCGAGTATCTCATCAACAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-1700s1c1
Sequence:CCGGCCTGATGATTGGACACTCAATCTCGAGATTGAGTGTCCAATCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011345
SELE MISSION shRNA shRNA Plasmid DNA
selectin E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-307s1c1
Sequence:CCGGCTACCTTAACTCCAATCTGAACTCGAGTTCAGATTGGAGTTAAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-504s1c1
Sequence:CCGGGCATGTGGAATGACGAGAGATCTCGAGATCTCTCGTCATTCCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-885s1c1
Sequence:CCGGCCCACGGTATCAGGAAATGTTCTCGAGAACATTTCCTGATACCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-1861s1c1
Sequence:CCGGGCTCTACTTGTTGATGAGATACTCGAGTATCTCATCAACAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-1700s1c1
Sequence:CCGGCCTGATGATTGGACACTCAATCTCGAGATTGAGTGTCCAATCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011345
SELE MISSION shRNA Lentiviral Transduction Particles
selectin E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-307s1c1
Sequence:CCGGCTACCTTAACTCCAATCTGAACTCGAGTTCAGATTGGAGTTAAGGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-504s1c1
Sequence:CCGGGCATGTGGAATGACGAGAGATCTCGAGATCTCTCGTCATTCCACATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-885s1c1
Sequence:CCGGCCCACGGTATCAGGAAATGTTCTCGAGAACATTTCCTGATACCGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-1861s1c1
Sequence:CCGGGCTCTACTTGTTGATGAGATACTCGAGTATCTCATCAACAAGTAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011345.1-1700s1c1
Sequence:CCGGCCTGATGATTGGACACTCAATCTCGAGATTGAGTGTCCAATCATCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???