EMAIL THIS PAGE TO A FRIEND

SELPLG

selectin P ligand

45 Gene Product Result for
Synonyms: CD162 CLA PSGL-1 PSGL1
Gene ID:
Human(6404) Summary: This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
Mouse(20345) selectin, platelet (p-selectin) ligand
Rat(363930) selectin P ligand
cow(617434) selectin P ligand
sheep(101102589) selectin P ligand
naked mole-rat(101713908) selectin P ligand
domestic guinea pig(100712957) selectin P ligand
Zebrafish(100884146) selectin P ligand
chicken(772212) selectin P ligand
dog(611673) selectin P ligand
Horse(100034025) selectin P ligand
domestic cat(101087945) selectin P ligand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1651 Human PSGL-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003006 Rosetta Predictions human pricing
NM_001013230 Rosetta Predictions rat pricing
NM_009151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110028 predicted 1768
2 SASI_Hs01_00110029 predicted 1634
3 SASI_Hs01_00110030 predicted 1810
4 SASI_Hs01_00110031 predicted 1029
5 SASI_Hs01_00110032 predicted 502
6 SASI_Hs02_00334895 predicted 1064
7 SASI_Hs01_00110033 predicted 656
8 SASI_Hs01_00110035 predicted 499
9 SASI_Hs01_00110036 predicted 287
10 SASI_Hs01_00110037 predicted 944
11 SASI_Hs01_00110034 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057743 predicted 760
2 SASI_Rn01_00057744 predicted 244
3 SASI_Rn01_00057745 predicted 246
4 SASI_Rn01_00057746 predicted 753
5 SASI_Rn02_00201043 predicted 573
6 SASI_Rn01_00057747 predicted 765
7 SASI_Rn01_00057748 predicted 748
8 SASI_Rn01_00057749 predicted 757
9 SASI_Rn01_00057750 predicted 761
10 SASI_Rn02_00201044 predicted 382
11 SASI_Rn01_00057742 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191893 predicted 937
2 SASI_Mm01_00191894 predicted 1251
3 SASI_Mm01_00191895 predicted 1110
4 SASI_Mm02_00315467 predicted 1843
5 SASI_Mm01_00191896 predicted 1431
6 SASI_Mm01_00191898 predicted 900
7 SASI_Mm02_00315468 predicted 1817
8 SASI_Mm01_00191899 predicted 381
9 SASI_Mm01_00191900 predicted 1498
10 SASI_Mm01_00191901 predicted 1208
11 SASI_Mm01_00191892 predicted 1500
12 SASI_Mm01_00191897 predicted 1002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003006
SELPLG MISSION shRNA Bacterial Glycerol Stock
selectin P ligand
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-926s1c1
Sequence:CCGGAGCCAGCAATTTGTCCGTCAACTCGAGTTGACGGACAAATTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-867s1c1
Sequence:CCGGAGAGGTCTGTTCATACCCTTTCTCGAGAAAGGGTATGAACAGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-411s1c1
Sequence:CCGGGCTATGGAGATACAGACCACTCTCGAGAGTGGTCTGTATCTCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-186s1c1
Sequence:CCGGGCCACCGAATATGAGTACCTACTCGAGTAGGTACTCATATTCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-207s1c1
Sequence:CCGGGATTATGATTTCCTGCCAGAACTCGAGTTCTGGCAGGAAATCATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003006.3-1613s21c1
Sequence:CCGGTCCAAGGCAGGAGGCCATTTACTCGAGTAAATGGCCTCCTGCCTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003006
SELPLG MISSION shRNA shRNA Plasmid DNA
selectin P ligand
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-926s1c1
Sequence:CCGGAGCCAGCAATTTGTCCGTCAACTCGAGTTGACGGACAAATTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-867s1c1
Sequence:CCGGAGAGGTCTGTTCATACCCTTTCTCGAGAAAGGGTATGAACAGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-411s1c1
Sequence:CCGGGCTATGGAGATACAGACCACTCTCGAGAGTGGTCTGTATCTCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-186s1c1
Sequence:CCGGGCCACCGAATATGAGTACCTACTCGAGTAGGTACTCATATTCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-207s1c1
Sequence:CCGGGATTATGATTTCCTGCCAGAACTCGAGTTCTGGCAGGAAATCATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003006.3-1613s21c1
Sequence:CCGGTCCAAGGCAGGAGGCCATTTACTCGAGTAAATGGCCTCCTGCCTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003006
SELPLG MISSION shRNA Lentiviral Transduction Particles
selectin P ligand
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-926s1c1
Sequence:CCGGAGCCAGCAATTTGTCCGTCAACTCGAGTTGACGGACAAATTGCTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-867s1c1
Sequence:CCGGAGAGGTCTGTTCATACCCTTTCTCGAGAAAGGGTATGAACAGACCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-411s1c1
Sequence:CCGGGCTATGGAGATACAGACCACTCTCGAGAGTGGTCTGTATCTCCATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-186s1c1
Sequence:CCGGGCCACCGAATATGAGTACCTACTCGAGTAGGTACTCATATTCGGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000057015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003006.2-207s1c1
Sequence:CCGGGATTATGATTTCCTGCCAGAACTCGAGTTCTGGCAGGAAATCATAATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000436811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003006.3-1613s21c1
Sequence:CCGGTCCAAGGCAGGAGGCCATTTACTCGAGTAAATGGCCTCCTGCCTTGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009151
SELPLG MISSION shRNA Bacterial Glycerol Stock
selectin P ligand
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-860s1c1
Sequence:CCGGCCACAGAGTCTAACGAGTCTACTCGAGTAGACTCGTTAGACTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-238s1c1
Sequence:CCGGGAGGACCCTGACTATACGTATCTCGAGATACGTATAGTCAGGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-771s1c1
Sequence:CCGGTCCCAGGATTCAGGCTGTAAACTCGAGTTTACAGCCTGAATCCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-1001s1c1
Sequence:CCGGTGAAGCAATGTCTGCTGATTACTCGAGTAATCAGCAGACATTGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-466s1c1
Sequence:CCGGCAGTGGAGTCTAACCTCAGTACTCGAGTACTGAGGTTAGACTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009151
SELPLG MISSION shRNA shRNA Plasmid DNA
selectin P ligand
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-860s1c1
Sequence:CCGGCCACAGAGTCTAACGAGTCTACTCGAGTAGACTCGTTAGACTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-238s1c1
Sequence:CCGGGAGGACCCTGACTATACGTATCTCGAGATACGTATAGTCAGGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-771s1c1
Sequence:CCGGTCCCAGGATTCAGGCTGTAAACTCGAGTTTACAGCCTGAATCCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-1001s1c1
Sequence:CCGGTGAAGCAATGTCTGCTGATTACTCGAGTAATCAGCAGACATTGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-466s1c1
Sequence:CCGGCAGTGGAGTCTAACCTCAGTACTCGAGTACTGAGGTTAGACTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009151
SELPLG MISSION shRNA Lentiviral Transduction Particles
selectin P ligand
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-860s1c1
Sequence:CCGGCCACAGAGTCTAACGAGTCTACTCGAGTAGACTCGTTAGACTCTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-238s1c1
Sequence:CCGGGAGGACCCTGACTATACGTATCTCGAGATACGTATAGTCAGGGTCCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-771s1c1
Sequence:CCGGTCCCAGGATTCAGGCTGTAAACTCGAGTTTACAGCCTGAATCCTGGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-1001s1c1
Sequence:CCGGTGAAGCAATGTCTGCTGATTACTCGAGTAATCAGCAGACATTGCTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009151.2-466s1c1
Sequence:CCGGCAGTGGAGTCTAACCTCAGTACTCGAGTACTGAGGTTAGACTCCACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???