EMAIL THIS PAGE TO A FRIEND

SEMA3B

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B

69 Gene Product Result for
Synonyms: LUCA-1 SEMA5 SEMAA SemA semaV
UniProtKB ID: Q13214, Q6GU46, Q8TB71, Q8TDV7, Q93018, Q96GX0
Gene ID:
Human(7869) Summary: The semaphorin/collapsin family of molecules plays a critical role in the guidance of growth cones during neuronal development. The secreted protein encoded by this gene family member is important in axonal guidance and has been shown to act as a tumor suppressor by inducing apoptosis. [provided by RefSeq, Jul 2008]
Mouse(20347) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Rat(363142) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
chicken(426234) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
domestic cat(101092422) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Horse(100062048) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
dog(484762) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
cow(539996) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
sheep(101121716) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
domestic guinea pig(100715631) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Domestic Rabbit(100339559) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
naked mole-rat(101699010) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005914 Rosetta Predictions human pricing
NM_004636 Rosetta Predictions human pricing
NM_001079942 Rosetta Predictions rat pricing
NM_001042779 Rosetta Predictions mouse pricing
NM_009153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305051 predicted 938
2 SASI_Hs01_00224103 predicted 574
3 SASI_Hs01_00224104 predicted 860
4 SASI_Hs01_00224105 predicted 812
5 SASI_Hs01_00224106 predicted 561
6 SASI_Hs01_00224107 predicted 440
7 SASI_Hs01_00224108 predicted 376
8 SASI_Hs01_00224109 predicted 880
9 SASI_Hs01_00224110 predicted 605
10 SASI_Hs01_00224111 predicted 1810
11 SASI_Hs01_00224112 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338037 predicted 944
2 SASI_Hs01_00051438 predicted 576
3 SASI_Hs01_00051439 predicted 859
4 SASI_Hs01_00051440 predicted 810
5 SASI_Hs01_00051441 predicted 565
6 SASI_Hs01_00051442 predicted 434
7 SASI_Hs01_00051443 predicted 375
8 SASI_Hs01_00051444 predicted 880
9 SASI_Hs01_00051445 predicted 605
10 SASI_Hs01_00051446 predicted 1813
11 SASI_Hs01_00051447 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208369 predicted 1583
2 SASI_Rn02_00208370 predicted 1297
3 SASI_Rn02_00208371 predicted 1442
4 SASI_Rn02_00208372 predicted 988
5 SASI_Rn02_00208373 predicted 695
6 SASI_Rn02_00208374 predicted 2227
7 SASI_Rn02_00208375 predicted 1579
8 SASI_Rn02_00208376 predicted 787
9 SASI_Rn02_00208377 predicted 438
10 SASI_Rn02_00208378 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291135 predicted 1576
2 SASI_Mm02_00291136 predicted 2669
3 SASI_Mm02_00291137 predicted 1099
4 SASI_Mm02_00291138 predicted 963
5 SASI_Mm02_00291139 predicted 1868
6 SASI_Mm02_00291140 predicted 1851
7 SASI_Mm02_00291141 predicted 2502
8 SASI_Mm02_00291142 predicted 1684
9 SASI_Mm02_00291143 predicted 1726
10 SASI_Mm02_00291144 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111403 predicted 1390
2 SASI_Mm01_00111404 predicted 2485
3 SASI_Mm01_00111405 predicted 908
4 SASI_Mm01_00111406 predicted 779
5 SASI_Mm01_00111407 predicted 1678
6 SASI_Mm01_00111408 predicted 1661
7 SASI_Mm01_00111409 predicted 2310
8 SASI_Mm01_00111412 predicted 1496
9 SASI_Mm02_00315470 predicted 1535
10 SASI_Mm02_00315471 predicted 526
11 SASI_Mm01_00111410 predicted 2131
12 SASI_Mm01_00111411 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004636
SEMA3B MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000378985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-1702s21c1
Sequence:CCGGCTGTCACCAGCATGCAAATTTCTCGAGAAATTTGCATGCTGGTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-605s21c1
Sequence:CCGGTGCCTACAACCGCACCCATTTCTCGAGAAATGGGTGCGGTTGTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-817s21c1
Sequence:CCGGACCTCATGGGACGAGACTTTACTCGAGTAAAGTCTCGTCCCATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004636
SEMA3B MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000378985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-1702s21c1
Sequence:CCGGCTGTCACCAGCATGCAAATTTCTCGAGAAATTTGCATGCTGGTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-605s21c1
Sequence:CCGGTGCCTACAACCGCACCCATTTCTCGAGAAATGGGTGCGGTTGTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-817s21c1
Sequence:CCGGACCTCATGGGACGAGACTTTACTCGAGTAAAGTCTCGTCCCATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004636
SEMA3B MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000378985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-1702s21c1
Sequence:CCGGCTGTCACCAGCATGCAAATTTCTCGAGAAATTTGCATGCTGGTGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-605s21c1
Sequence:CCGGTGCCTACAACCGCACCCATTTCTCGAGAAATGGGTGCGGTTGTAGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004636.2-817s21c1
Sequence:CCGGACCTCATGGGACGAGACTTTACTCGAGTAAAGTCTCGTCCCATGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009153
VALIDATED
SEMA3B MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009153.1-873s1c1
Sequence:CCGGCCCAAGTTTGTCAAGGTCTTTCTCGAGAAAGACCTTGACAAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009153.1-1863s1c1
Sequence:CCGGCGGAGGCAAGACATAAGGAATCTCGAGATTCCTTATGTCTTGCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-303s1c1
Sequence:CCGGCGGCTCTCCTTTCAAGAATTACTCGAGTAATTCTTGAAAGGAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-1607s1c1
Sequence:CCGGGCGACCTAATTCTGAAGGACTCTCGAGAGTCCTTCAGAATTAGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-1389s1c1
Sequence:CCGGCCAGATGACGTTATCCAGTTTCTCGAGAAACTGGATAACGTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009153
VALIDATED
SEMA3B MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009153.1-873s1c1
Sequence:CCGGCCCAAGTTTGTCAAGGTCTTTCTCGAGAAAGACCTTGACAAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009153.1-1863s1c1
Sequence:CCGGCGGAGGCAAGACATAAGGAATCTCGAGATTCCTTATGTCTTGCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-303s1c1
Sequence:CCGGCGGCTCTCCTTTCAAGAATTACTCGAGTAATTCTTGAAAGGAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-1607s1c1
Sequence:CCGGGCGACCTAATTCTGAAGGACTCTCGAGAGTCCTTCAGAATTAGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-1389s1c1
Sequence:CCGGCCAGATGACGTTATCCAGTTTCTCGAGAAACTGGATAACGTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009153
VALIDATED
SEMA3B MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009153.1-873s1c1
Sequence:CCGGCCCAAGTTTGTCAAGGTCTTTCTCGAGAAAGACCTTGACAAACTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009153.1-1863s1c1
Sequence:CCGGCGGAGGCAAGACATAAGGAATCTCGAGATTCCTTATGTCTTGCCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-303s1c1
Sequence:CCGGCGGCTCTCCTTTCAAGAATTACTCGAGTAATTCTTGAAAGGAGAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-1607s1c1
Sequence:CCGGGCGACCTAATTCTGAAGGACTCTCGAGAGTCCTTCAGAATTAGGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009153.1-1389s1c1
Sequence:CCGGCCAGATGACGTTATCCAGTTTCTCGAGAAACTGGATAACGTCATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)