EMAIL THIS PAGE TO A FRIEND

SEMA3F

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F

104 Gene Product Result for
Synonyms: SEMA-IV SEMA4 SEMAK
UniProtKB ID: Q13275, Q13274, Q13372, Q15704, Q6GTR4
Gene ID:
Human(6405) Summary: The semaphorins are a family of proteins that are involved in signaling. All the family members have a secretion signal, a 500-amino acid sema domain, and 16 conserved cysteine residues (Kolodkin et al., 1993 [PubMed 8269517]
Mouse(20350) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Rat(315996) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3 F
cow(531141) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
sheep(101122223) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
domestic guinea pig(100714426) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
naked mole-rat(101725304) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
chicken(374109) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
dog(484763) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Horse(100062215) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
domestic cat(101091515) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004186 Rosetta Predictions human pricing
XM_001073412 Rosetta Predictions rat pricing
XM_236623 Rosetta Predictions rat pricing
NM_011349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337071 predicted 393
2 SASI_Hs01_00032460 predicted 1006
3 SASI_Hs01_00032461 predicted 1305
4 SASI_Hs01_00032462 predicted 2094
5 SASI_Hs01_00032463 predicted 1090
6 SASI_Hs01_00032464 predicted 1480
7 SASI_Hs02_00337072 predicted 1326
8 SASI_Hs02_00337073 predicted 2219
9 SASI_Hs01_00032467 predicted 2238
10 SASI_Hs01_00032468 predicted 1434
11 SASI_Hs01_00032459 predicted 1996
12 SASI_Hs01_00032465 predicted 1121
13 SASI_Hs01_00032466 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342761 predicted 770
2 SASI_Rn02_00342762 predicted 1135
3 SASI_Rn02_00342763 predicted 304
4 SASI_Rn02_00342764 predicted 998
5 SASI_Rn02_00342765 predicted 1302
6 SASI_Rn02_00342766 predicted 828
7 SASI_Rn02_00342767 predicted 1301
8 SASI_Rn02_00342768 predicted 822
9 SASI_Rn02_00342769 predicted 2028
10 SASI_Rn02_00342770 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390239 predicted 763
2 SASI_Rn02_00390240 predicted 1136
3 SASI_Rn02_00390241 predicted 308
4 SASI_Rn02_00390242 predicted 997
5 SASI_Rn02_00390243 predicted 1307
6 SASI_Rn02_00390244 predicted 822
7 SASI_Rn02_00390245 predicted 1300
8 SASI_Rn02_00390246 predicted 824
9 SASI_Rn02_00390247 predicted 2032
10 SASI_Rn02_00390248 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172545 predicted 857
2 SASI_Mm01_00172546 predicted 543
3 SASI_Mm01_00172547 predicted 1219
4 SASI_Mm01_00172548 predicted 292
5 SASI_Mm01_00172549 predicted 352
6 SASI_Mm01_00172550 predicted 366
7 SASI_Mm01_00172551 predicted 1365
8 SASI_Mm01_00172552 predicted 917
9 SASI_Mm01_00172553 predicted 1236
10 SASI_Mm01_00172554 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004186
SEMA3F MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-855s21c1
Sequence:CCGGTGCTGGTGTGTACATCGATTTCTCGAGAAATCGATGTACACACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-1255s1c1
Sequence:CCGGCCTGTCATTTACGCTGTCTTTCTCGAGAAAGACAGCGTAAATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-2235s1c1
Sequence:CCGGAGCCACTGAGAACAACTTTAACTCGAGTTAAAGTTGTTCTCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-1005s1c1
Sequence:CCGGGCGCAATGATGATAAGCTTTACTCGAGTAAAGCTTATCATCATTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-297s1c1
Sequence:CCGGGCTCTCATTCAAAGAGCTGAACTCGAGTTCAGCTCTTTGAATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-363s1c1
Sequence:CCGGCGACTACCGAATCTTGCTCAACTCGAGTTGAGCAAGATTCGGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-1316s21c1
Sequence:CCGGTCTACTCCATGGCTGATATTCCTCGAGGAATATCAGCCATGGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-1441s21c1
Sequence:CCGGGGAACCTTCACGCCATCTATGCTCGAGCATAGATGGCGTGAAGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004186
SEMA3F MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-855s21c1
Sequence:CCGGTGCTGGTGTGTACATCGATTTCTCGAGAAATCGATGTACACACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-1255s1c1
Sequence:CCGGCCTGTCATTTACGCTGTCTTTCTCGAGAAAGACAGCGTAAATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-2235s1c1
Sequence:CCGGAGCCACTGAGAACAACTTTAACTCGAGTTAAAGTTGTTCTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-1005s1c1
Sequence:CCGGGCGCAATGATGATAAGCTTTACTCGAGTAAAGCTTATCATCATTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-297s1c1
Sequence:CCGGGCTCTCATTCAAAGAGCTGAACTCGAGTTCAGCTCTTTGAATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-363s1c1
Sequence:CCGGCGACTACCGAATCTTGCTCAACTCGAGTTGAGCAAGATTCGGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-1316s21c1
Sequence:CCGGTCTACTCCATGGCTGATATTCCTCGAGGAATATCAGCCATGGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-1441s21c1
Sequence:CCGGGGAACCTTCACGCCATCTATGCTCGAGCATAGATGGCGTGAAGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004186
SEMA3F MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-855s21c1
Sequence:CCGGTGCTGGTGTGTACATCGATTTCTCGAGAAATCGATGTACACACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-1255s1c1
Sequence:CCGGCCTGTCATTTACGCTGTCTTTCTCGAGAAAGACAGCGTAAATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-2235s1c1
Sequence:CCGGAGCCACTGAGAACAACTTTAACTCGAGTTAAAGTTGTTCTCAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-1005s1c1
Sequence:CCGGGCGCAATGATGATAAGCTTTACTCGAGTAAAGCTTATCATCATTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-297s1c1
Sequence:CCGGGCTCTCATTCAAAGAGCTGAACTCGAGTTCAGCTCTTTGAATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004186.2-363s1c1
Sequence:CCGGCGACTACCGAATCTTGCTCAACTCGAGTTGAGCAAGATTCGGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-1316s21c1
Sequence:CCGGTCTACTCCATGGCTGATATTCCTCGAGGAATATCAGCCATGGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004186.3-1441s21c1
Sequence:CCGGGGAACCTTCACGCCATCTATGCTCGAGCATAGATGGCGTGAAGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011349
VALIDATED
SEMA3F MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-1166s1c1
Sequence:CCGGCCAGTCATTTATGCTGTCTTTCTCGAGAAAGACAGCATAAATGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-745s1c1
Sequence:CCGGCCTCATCAATGAGGAACTCTACTCGAGTAGAGTTCCTCATTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011349.2-911s1c1
Sequence:CCGGGCAGAGCGCAATGACGATAAACTCGAGTTTATCGTCATTGCGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-652s1c1
Sequence:CCGGCGCACAGGATTACATCTTCTACTCGAGTAGAAGATGTAATCCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-299s1c1
Sequence:CCGGCGACTGTCATTCAAAGAACTTCTCGAGAAGTTCTTTGAATGACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011349
VALIDATED
SEMA3F MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-1166s1c1
Sequence:CCGGCCAGTCATTTATGCTGTCTTTCTCGAGAAAGACAGCATAAATGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-745s1c1
Sequence:CCGGCCTCATCAATGAGGAACTCTACTCGAGTAGAGTTCCTCATTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011349.2-911s1c1
Sequence:CCGGGCAGAGCGCAATGACGATAAACTCGAGTTTATCGTCATTGCGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-652s1c1
Sequence:CCGGCGCACAGGATTACATCTTCTACTCGAGTAGAAGATGTAATCCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-299s1c1
Sequence:CCGGCGACTGTCATTCAAAGAACTTCTCGAGAAGTTCTTTGAATGACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011349
VALIDATED
SEMA3F MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-1166s1c1
Sequence:CCGGCCAGTCATTTATGCTGTCTTTCTCGAGAAAGACAGCATAAATGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-745s1c1
Sequence:CCGGCCTCATCAATGAGGAACTCTACTCGAGTAGAGTTCCTCATTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011349.2-911s1c1
Sequence:CCGGGCAGAGCGCAATGACGATAAACTCGAGTTTATCGTCATTGCGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-652s1c1
Sequence:CCGGCGCACAGGATTACATCTTCTACTCGAGTAGAAGATGTAATCCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011349.2-299s1c1
Sequence:CCGGCGACTGTCATTCAAAGAACTTCTCGAGAAGTTCTTTGAATGACAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)