EMAIL THIS PAGE TO A FRIEND

SEMA3G

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G

74 Gene Product Result for
Synonyms: sem2
UniProtKB ID: Q9NS98, Q7L9D9, Q9H7Q3
Gene ID:
Mouse(218877) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Rat(290562) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
chicken(415945) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
domestic cat(101082730) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Horse(100060213) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
dog(484736) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
naked mole-rat(101702993) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Domestic Rabbit(100346280) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
domestic guinea pig(100730801) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
cow(100299041) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
sheep(101111838) sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029041 MISSION® esiRNA esiRNA human SEMA3G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020163 Rosetta Predictions human pricing
XM_001062426 Rosetta Predictions rat pricing
XM_224613 Rosetta Predictions rat pricing
NM_001025379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200648 predicted 2593
2 SASI_Hs01_00200649 predicted 1337
3 SASI_Hs01_00200650 predicted 2652
4 SASI_Hs01_00200651 predicted 1475
5 SASI_Hs01_00200653 predicted 334
6 SASI_Hs01_00200654 predicted 1931
7 SASI_Hs02_00353065 predicted 2597
8 SASI_Hs01_00200655 predicted 1926
9 SASI_Hs01_00200656 predicted 1870
10 SASI_Hs02_00353066 predicted 1469
11 SASI_Hs01_00200647 predicted 2816
12 SASI_Hs01_00200652 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303437 predicted 215
2 SASI_Rn02_00303438 predicted 507
3 SASI_Rn02_00303439 predicted 2461
4 SASI_Rn02_00303440 predicted 1057
5 SASI_Rn02_00303441 predicted 1010
6 SASI_Rn02_00303442 predicted 1984
7 SASI_Rn02_00303443 predicted 347
8 SASI_Rn02_00303444 predicted 331
9 SASI_Rn02_00303445 predicted 2357
10 SASI_Rn02_00303446 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382088 predicted 215
2 SASI_Rn02_00382089 predicted 259
3 SASI_Rn02_00382090 predicted 508
4 SASI_Rn02_00382091 predicted 377
5 SASI_Rn02_00382092 predicted 1055
6 SASI_Rn02_00382093 predicted 1006
7 SASI_Rn02_00382094 predicted 1112
8 SASI_Rn02_00382095 predicted 1375
9 SASI_Rn02_00382096 predicted 792
10 SASI_Rn02_00382097 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100488 predicted 2460
2 SASI_Mm01_00100489 predicted 332
3 SASI_Mm01_00100491 predicted 1062
4 SASI_Mm01_00100492 predicted 2048
5 SASI_Mm01_00100493 predicted 2469
6 SASI_Mm01_00100494 predicted 226
7 SASI_Mm01_00100495 predicted 383
8 SASI_Mm01_00100496 predicted 1075
9 SASI_Mm02_00287853 predicted 1411
10 SASI_Mm01_00100497 predicted 613
11 SASI_Mm01_00100490 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020163
SEMA3G MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020163.1-1446s21c1
Sequence:CCGGGGAGGAGCTCCAGGTGTTTAACTCGAGTTAAACACCTGGAGCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020163.1-1772s21c1
Sequence:CCGGTCTACGGCACGGAGCACAATACTCGAGTATTGTGCTCCGTGCCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1554s1c1
Sequence:CCGGGCTGCACCAATGTGAGACTTACTCGAGTAAGTCTCACATTGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1927s1c1
Sequence:CCGGCGCAGGCTTAGCCGTTTCGATCTCGAGATCGAAACGGCTAAGCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1342s1c1
Sequence:CCGGGATGGGACCTACGATGTCATTCTCGAGAATGACATCGTAGGTCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-711s1c1
Sequence:CCGGCCAGGACAATGACAAGGTGTACTCGAGTACACCTTGTCATTGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1470s1c1
Sequence:CCGGGCCAACACCTATCACCGAAATCTCGAGATTTCGGTGATAGGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020163
SEMA3G MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020163.1-1446s21c1
Sequence:CCGGGGAGGAGCTCCAGGTGTTTAACTCGAGTTAAACACCTGGAGCTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020163.1-1772s21c1
Sequence:CCGGTCTACGGCACGGAGCACAATACTCGAGTATTGTGCTCCGTGCCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1554s1c1
Sequence:CCGGGCTGCACCAATGTGAGACTTACTCGAGTAAGTCTCACATTGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1927s1c1
Sequence:CCGGCGCAGGCTTAGCCGTTTCGATCTCGAGATCGAAACGGCTAAGCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1342s1c1
Sequence:CCGGGATGGGACCTACGATGTCATTCTCGAGAATGACATCGTAGGTCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-711s1c1
Sequence:CCGGCCAGGACAATGACAAGGTGTACTCGAGTACACCTTGTCATTGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1470s1c1
Sequence:CCGGGCCAACACCTATCACCGAAATCTCGAGATTTCGGTGATAGGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020163
SEMA3G MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020163.1-1446s21c1
Sequence:CCGGGGAGGAGCTCCAGGTGTTTAACTCGAGTTAAACACCTGGAGCTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020163.1-1772s21c1
Sequence:CCGGTCTACGGCACGGAGCACAATACTCGAGTATTGTGCTCCGTGCCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1554s1c1
Sequence:CCGGGCTGCACCAATGTGAGACTTACTCGAGTAAGTCTCACATTGGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1927s1c1
Sequence:CCGGCGCAGGCTTAGCCGTTTCGATCTCGAGATCGAAACGGCTAAGCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1342s1c1
Sequence:CCGGGATGGGACCTACGATGTCATTCTCGAGAATGACATCGTAGGTCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-711s1c1
Sequence:CCGGCCAGGACAATGACAAGGTGTACTCGAGTACACCTTGTCATTGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020163.1-1470s1c1
Sequence:CCGGGCCAACACCTATCACCGAAATCTCGAGATTTCGGTGATAGGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025379
VALIDATED
SEMA3G MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-603s21c1
Sequence:CCGGACAGGTCTCACTGCCGATTTCCTCGAGGAAATCGGCAGTGAGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-2207s21c1
Sequence:CCGGTGAGTACTGTGAACGTGTATGCTCGAGCATACACGTTCACAGTACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025379.1-868s21c1
Sequence:CCGGAGCGGGTGCTGGTGAACAAATCTCGAGATTTGTTCACCAGCACCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-514s21c1
Sequence:CCGGATGCTAGCAGCGTCGAGAATGCTCGAGCATTCTCGACGCTGCTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-2761s21c1
Sequence:CCGGGTGGCTCTAAGGGAGTATATACTCGAGTATATACTCCCTTAGAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025379
VALIDATED
SEMA3G MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-603s21c1
Sequence:CCGGACAGGTCTCACTGCCGATTTCCTCGAGGAAATCGGCAGTGAGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-2207s21c1
Sequence:CCGGTGAGTACTGTGAACGTGTATGCTCGAGCATACACGTTCACAGTACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025379.1-868s21c1
Sequence:CCGGAGCGGGTGCTGGTGAACAAATCTCGAGATTTGTTCACCAGCACCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-514s21c1
Sequence:CCGGATGCTAGCAGCGTCGAGAATGCTCGAGCATTCTCGACGCTGCTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-2761s21c1
Sequence:CCGGGTGGCTCTAAGGGAGTATATACTCGAGTATATACTCCCTTAGAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025379
VALIDATED
SEMA3G MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-603s21c1
Sequence:CCGGACAGGTCTCACTGCCGATTTCCTCGAGGAAATCGGCAGTGAGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-2207s21c1
Sequence:CCGGTGAGTACTGTGAACGTGTATGCTCGAGCATACACGTTCACAGTACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025379.1-868s21c1
Sequence:CCGGAGCGGGTGCTGGTGAACAAATCTCGAGATTTGTTCACCAGCACCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-514s21c1
Sequence:CCGGATGCTAGCAGCGTCGAGAATGCTCGAGCATTCTCGACGCTGCTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025379.1-2761s21c1
Sequence:CCGGGTGGCTCTAAGGGAGTATATACTCGAGTATATACTCCCTTAGAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)