EMAIL THIS PAGE TO A FRIEND

SEMA4F

sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F

170 Gene Product Result for
Synonyms: M-SEMA PRO2353 S4F SEMAM SEMAW m-Sema-M
UniProtKB ID: O95754, Q542Y7, Q9NS35
Gene ID:
Human(10505) Summary: This gene encodes a transmembrane class IV semaphorin family protein, which plays a role in neural development. This gene may be involved in neurogenesis in prostate cancer, the development of neurofibromas, and breast cancer tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(20355) sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Rat(29745) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
dog(483098) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Horse(100068980) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
domestic cat(101088923) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
cow(530018) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
sheep(101120908) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
domestic guinea pig(100732935) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Domestic Rabbit(100347884) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
naked mole-rat(101722750) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004263 Rosetta Predictions human pricing
NM_019272 Rosetta Predictions rat pricing
NM_001113481 Rosetta Predictions mouse pricing
NM_011350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220226 predicted 2181
2 SASI_Hs01_00220227 predicted 2425
3 SASI_Hs01_00220228 predicted 1973
4 SASI_Hs01_00220229 predicted 1608
5 SASI_Hs01_00220230 predicted 661
6 SASI_Hs01_00220231 predicted 1150
7 SASI_Hs01_00220233 predicted 1161
8 SASI_Hs01_00220235 predicted 1119
9 SASI_Hs02_00337226 predicted 879
10 SASI_Hs02_00337227 predicted 2517
11 SASI_Hs01_00220232 predicted 301
12 SASI_Hs01_00220234 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262187 predicted 2386
2 SASI_Rn01_00113041 predicted 2449
3 SASI_Rn01_00113042 predicted 540
4 SASI_Rn01_00113043 predicted 1786
5 SASI_Rn01_00113044 predicted 2169
6 SASI_Rn01_00113045 predicted 1547
7 SASI_Rn01_00113046 predicted 1481
8 SASI_Rn01_00113047 predicted 2435
9 SASI_Rn01_00113048 predicted 552
10 SASI_Rn01_00113049 predicted 1316
11 SASI_Rn01_00113050 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307983 predicted 1374
2 SASI_Mm02_00307984 predicted 869
3 SASI_Mm02_00307985 predicted 1188
4 SASI_Mm02_00307986 predicted 592
5 SASI_Mm02_00307987 predicted 1312
6 SASI_Mm02_00307988 predicted 697
7 SASI_Mm02_00307989 predicted 926
8 SASI_Mm02_00307990 predicted 606
9 SASI_Mm02_00307991 predicted 790
10 SASI_Mm02_00307992 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320493 predicted 1370
2 SASI_Mm02_00320494 predicted 868
3 SASI_Mm02_00320495 predicted 1187
4 SASI_Mm01_00039716 predicted 592
5 SASI_Mm01_00039718 predicted 1320
6 SASI_Mm01_00039719 predicted 702
7 SASI_Mm01_00039721 predicted 924
8 SASI_Mm01_00039723 predicted 600
9 SASI_Mm01_00039724 predicted 789
10 SASI_Mm02_00320496 predicted 1543
11 SASI_Mm01_00039715 predicted 2471
12 SASI_Mm01_00039717 predicted 2187
13 SASI_Mm01_00039720 predicted 2489
14 SASI_Mm01_00039722 predicted 2112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011350
VALIDATED
SEMA4F MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000112273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-420s1c1
Sequence:CCGGCAGACAGAACTGTAGGAAGAACTCGAGTTCTTCCTACAGTTCTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-3662s1c1
Sequence:CCGGGCCTCCTTTCTTGCTTCATTACTCGAGTAATGAAGCAAGAAAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-429s1c1
Sequence:CCGGCTGTAGGAAGAAAGGCAAGAACTCGAGTTCTTGCCTTTCTTCCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011350.2-1161s1c1
Sequence:CCGGTGGTCCCTTTAGAGAGCTAAACTCGAGTTTAGCTCTCTAAAGGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011350
VALIDATED
SEMA4F MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000112273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-420s1c1
Sequence:CCGGCAGACAGAACTGTAGGAAGAACTCGAGTTCTTCCTACAGTTCTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-3662s1c1
Sequence:CCGGGCCTCCTTTCTTGCTTCATTACTCGAGTAATGAAGCAAGAAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-429s1c1
Sequence:CCGGCTGTAGGAAGAAAGGCAAGAACTCGAGTTCTTGCCTTTCTTCCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011350.2-1161s1c1
Sequence:CCGGTGGTCCCTTTAGAGAGCTAAACTCGAGTTTAGCTCTCTAAAGGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011350
VALIDATED
SEMA4F MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000112273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-420s1c1
Sequence:CCGGCAGACAGAACTGTAGGAAGAACTCGAGTTCTTCCTACAGTTCTGTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-3662s1c1
Sequence:CCGGGCCTCCTTTCTTGCTTCATTACTCGAGTAATGAAGCAAGAAAGGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011350.2-429s1c1
Sequence:CCGGCTGTAGGAAGAAAGGCAAGAACTCGAGTTCTTGCCTTTCTTCCTACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011350.2-1161s1c1
Sequence:CCGGTGGTCCCTTTAGAGAGCTAAACTCGAGTTTAGCTCTCTAAAGGGACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004263
VALIDATED
SEMA4F MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-1762s1c1
Sequence:CCGGCAAGACATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-1619s1c1
Sequence:CCGGCTGAGGTGACACAAGTGAATACTCGAGTATTCACTTGTGTCACCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004263.2-886s1c1
Sequence:CCGGGACTCATACGAGCGCATTAAACTCGAGTTTAATGCGCTCGTATGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-231s1c1
Sequence:CCGGGCCCAGAACCTCGCTTCCAATCTCGAGATTGGAAGCGAGGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-886s21c1
Sequence:CCGGGACTCATACGAGCGCATTAAACTCGAGTTTAATGCGCTCGTATGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-1762s21c1
Sequence:CCGGCAAGACATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-231s21c1
Sequence:CCGGGCCCAGAACCTCGCTTCCAATCTCGAGATTGGAAGCGAGGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-1619s21c1
Sequence:CCGGCTGAGGTGACACAAGTGAATACTCGAGTATTCACTTGTGTCACCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004263
VALIDATED
SEMA4F MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-1762s1c1
Sequence:CCGGCAAGACATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-1619s1c1
Sequence:CCGGCTGAGGTGACACAAGTGAATACTCGAGTATTCACTTGTGTCACCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004263.2-886s1c1
Sequence:CCGGGACTCATACGAGCGCATTAAACTCGAGTTTAATGCGCTCGTATGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-231s1c1
Sequence:CCGGGCCCAGAACCTCGCTTCCAATCTCGAGATTGGAAGCGAGGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-886s21c1
Sequence:CCGGGACTCATACGAGCGCATTAAACTCGAGTTTAATGCGCTCGTATGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-1762s21c1
Sequence:CCGGCAAGACATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-231s21c1
Sequence:CCGGGCCCAGAACCTCGCTTCCAATCTCGAGATTGGAAGCGAGGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-1619s21c1
Sequence:CCGGCTGAGGTGACACAAGTGAATACTCGAGTATTCACTTGTGTCACCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004263
VALIDATED
SEMA4F MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-1762s1c1
Sequence:CCGGCAAGACATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATGTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-1619s1c1
Sequence:CCGGCTGAGGTGACACAAGTGAATACTCGAGTATTCACTTGTGTCACCTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004263.2-886s1c1
Sequence:CCGGGACTCATACGAGCGCATTAAACTCGAGTTTAATGCGCTCGTATGAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004263.2-231s1c1
Sequence:CCGGGCCCAGAACCTCGCTTCCAATCTCGAGATTGGAAGCGAGGTTCTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000307634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-886s21c1
Sequence:CCGGGACTCATACGAGCGCATTAAACTCGAGTTTAATGCGCTCGTATGAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-1762s21c1
Sequence:CCGGCAAGACATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATGTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-231s21c1
Sequence:CCGGGCCCAGAACCTCGCTTCCAATCTCGAGATTGGAAGCGAGGTTCTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004263.3-1619s21c1
Sequence:CCGGCTGAGGTGACACAAGTGAATACTCGAGTATTCACTTGTGTCACCTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???