EMAIL THIS PAGE TO A FRIEND

SEMA4G

sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G

279 Gene Product Result for
UniProtKB ID: Q9NTN9, A1A5C6, A6NJY8, Q58EY1, Q9HCF3
Gene ID:
Human(57715) Summary: Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(26456) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Rat(361764) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
naked mole-rat(101719579) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
domestic guinea pig(100734927) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
cow(524002) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
sheep(101122740) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Zebrafish(100534852) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Horse(100070304) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
domestic cat(101093464) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
dog(486844) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
chicken(423857) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017893 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017893 Rosetta Predictions human pricing
XM_001063153 Rosetta Predictions rat pricing
XM_342055 Rosetta Predictions rat pricing
NM_011976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162836 predicted 1708
2 SASI_Hs01_00162837 predicted 2028
3 SASI_Hs01_00162838 predicted 1775
4 SASI_Hs01_00162839 predicted 1538
5 SASI_Hs01_00162840 predicted 1417
6 SASI_Hs01_00162841 predicted 2097
7 SASI_Hs01_00162842 predicted 2028
8 SASI_Hs01_00162843 predicted 2409
9 SASI_Hs01_00162844 predicted 807
10 SASI_Hs01_00162845 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305997 predicted 2416
2 SASI_Rn02_00305998 predicted 1728
3 SASI_Rn02_00305999 predicted 2941
4 SASI_Rn02_00306000 predicted 785
5 SASI_Rn02_00306001 predicted 967
6 SASI_Rn02_00306002 predicted 1050
7 SASI_Rn02_00306003 predicted 1802
8 SASI_Rn02_00306004 predicted 2109
9 SASI_Rn02_00306005 predicted 771
10 SASI_Rn02_00306006 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393694 predicted 2416
2 SASI_Rn02_00393695 predicted 1735
3 SASI_Rn02_00393696 predicted 2940
4 SASI_Rn02_00393697 predicted 791
5 SASI_Rn02_00393698 predicted 965
6 SASI_Rn02_00393699 predicted 1047
7 SASI_Rn02_00393700 predicted 1807
8 SASI_Rn02_00393701 predicted 2107
9 SASI_Rn02_00393702 predicted 770
10 SASI_Rn02_00393703 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081500 predicted 724
2 SASI_Mm01_00081501 predicted 943
3 SASI_Mm01_00081502 predicted 689
4 SASI_Mm01_00081503 predicted 2079
5 SASI_Mm01_00081504 predicted 1707
6 SASI_Mm01_00081505 predicted 1301
7 SASI_Mm01_00081506 predicted 1407
8 SASI_Mm01_00081507 predicted 1409
9 SASI_Mm01_00081508 predicted 1774
10 SASI_Mm01_00081509 predicted 2390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011976
VALIDATED
SEMA4G MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-734s21c1
Sequence:CCGGTGTTTCAACCACGTGCGATTTCTCGAGAAATCGCACGTGGTTGAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011976.1-3645s21c1
Sequence:CCGGCCAGATCAAGTGCTTACATTTCTCGAGAAATGTAAGCACTTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-1819s21c1
Sequence:CCGGGTCTGTGGACAATCTAGTTATCTCGAGATAACTAGATTGTCCACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-1305s1c1
Sequence:CCGGGCCTGAATGCTGATACATCATCTCGAGATGATGTATCAGCATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-944s1c1
Sequence:CCGGCGGTATGAATTCCGGAGCATTCTCGAGAATGCTCCGGAATTCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011976.1-2002s1c1
Sequence:CCGGCGTAGCCAACAGGACAGAATTCTCGAGAATTCTGTCCTGTTGGCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011976.1-1302s1c1
Sequence:CCGGGCAGCCTGAATGCTGATACATCTCGAGATGTATCAGCATTCAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-944s21c1
Sequence:CCGGCGGTATGAATTCCGGAGCATTCTCGAGAATGCTCCGGAATTCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-624s21c1
Sequence:CCGGCTCTCAGTGCCCGTGACATAACTCGAGTTATGTCACGGGCACTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-3645s1c1
Sequence:CCGGCCAGATCAAGTGCTTACATTTCTCGAGAAATGTAAGCACTTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011976
VALIDATED
SEMA4G MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-734s21c1
Sequence:CCGGTGTTTCAACCACGTGCGATTTCTCGAGAAATCGCACGTGGTTGAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011976.1-3645s21c1
Sequence:CCGGCCAGATCAAGTGCTTACATTTCTCGAGAAATGTAAGCACTTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-1819s21c1
Sequence:CCGGGTCTGTGGACAATCTAGTTATCTCGAGATAACTAGATTGTCCACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-1305s1c1
Sequence:CCGGGCCTGAATGCTGATACATCATCTCGAGATGATGTATCAGCATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-944s1c1
Sequence:CCGGCGGTATGAATTCCGGAGCATTCTCGAGAATGCTCCGGAATTCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011976.1-2002s1c1
Sequence:CCGGCGTAGCCAACAGGACAGAATTCTCGAGAATTCTGTCCTGTTGGCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011976.1-1302s1c1
Sequence:CCGGGCAGCCTGAATGCTGATACATCTCGAGATGTATCAGCATTCAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-944s21c1
Sequence:CCGGCGGTATGAATTCCGGAGCATTCTCGAGAATGCTCCGGAATTCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-624s21c1
Sequence:CCGGCTCTCAGTGCCCGTGACATAACTCGAGTTATGTCACGGGCACTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-3645s1c1
Sequence:CCGGCCAGATCAAGTGCTTACATTTCTCGAGAAATGTAAGCACTTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011976
VALIDATED
SEMA4G MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-734s21c1
Sequence:CCGGTGTTTCAACCACGTGCGATTTCTCGAGAAATCGCACGTGGTTGAAACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011976.1-3645s21c1
Sequence:CCGGCCAGATCAAGTGCTTACATTTCTCGAGAAATGTAAGCACTTGATCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-1819s21c1
Sequence:CCGGGTCTGTGGACAATCTAGTTATCTCGAGATAACTAGATTGTCCACAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-1305s1c1
Sequence:CCGGGCCTGAATGCTGATACATCATCTCGAGATGATGTATCAGCATTCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-944s1c1
Sequence:CCGGCGGTATGAATTCCGGAGCATTCTCGAGAATGCTCCGGAATTCATACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011976.1-2002s1c1
Sequence:CCGGCGTAGCCAACAGGACAGAATTCTCGAGAATTCTGTCCTGTTGGCTACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011976.1-1302s1c1
Sequence:CCGGGCAGCCTGAATGCTGATACATCTCGAGATGTATCAGCATTCAGGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-944s21c1
Sequence:CCGGCGGTATGAATTCCGGAGCATTCTCGAGAATGCTCCGGAATTCATACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011976.1-624s21c1
Sequence:CCGGCTCTCAGTGCCCGTGACATAACTCGAGTTATGTCACGGGCACTGAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011976.1-3645s1c1
Sequence:CCGGCCAGATCAAGTGCTTACATTTCTCGAGAAATGTAAGCACTTGATCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017893
VALIDATED
SEMA4G MISSION shRNA Bacterial Glycerol Stock
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1705s21c1
Sequence:CCGGCCTACCTATGACCTGCTCTTTCTCGAGAAAGAGCAGGTCATAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-483s21c1
Sequence:CCGGCCCTCGGATGACCATACCCTACTCGAGTAGGGTATGGTCATCCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-483s1c1
Sequence:CCGGCCCTCGGATGACCATACCCTACTCGAGTAGGGTATGGTCATCCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1435s1c1
Sequence:CCGGCCCTATATGGAATACCAGGATCTCGAGATCCTGGTATTCCATATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1508s1c1
Sequence:CCGGGCTCGTGTATCACAGATTCATCTCGAGATGAATCTGTGATACACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-2422s1c1
Sequence:CCGGCTGCTCTATGTGCTAGCCATTCTCGAGAATGGCTAGCACATAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1435s21c1
Sequence:CCGGCCCTATATGGAATACCAGGATCTCGAGATCCTGGTATTCCATATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1508s21c1
Sequence:CCGGGCTCGTGTATCACAGATTCATCTCGAGATGAATCTGTGATACACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1705s1c1
Sequence:CCGGCCTACCTATGACCTGCTCTTTCTCGAGAAAGAGCAGGTCATAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017893
VALIDATED
SEMA4G MISSION shRNA shRNA Plasmid DNA
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1705s21c1
Sequence:CCGGCCTACCTATGACCTGCTCTTTCTCGAGAAAGAGCAGGTCATAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-483s21c1
Sequence:CCGGCCCTCGGATGACCATACCCTACTCGAGTAGGGTATGGTCATCCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-483s1c1
Sequence:CCGGCCCTCGGATGACCATACCCTACTCGAGTAGGGTATGGTCATCCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1435s1c1
Sequence:CCGGCCCTATATGGAATACCAGGATCTCGAGATCCTGGTATTCCATATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1508s1c1
Sequence:CCGGGCTCGTGTATCACAGATTCATCTCGAGATGAATCTGTGATACACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-2422s1c1
Sequence:CCGGCTGCTCTATGTGCTAGCCATTCTCGAGAATGGCTAGCACATAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1435s21c1
Sequence:CCGGCCCTATATGGAATACCAGGATCTCGAGATCCTGGTATTCCATATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1508s21c1
Sequence:CCGGGCTCGTGTATCACAGATTCATCTCGAGATGAATCTGTGATACACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1705s1c1
Sequence:CCGGCCTACCTATGACCTGCTCTTTCTCGAGAAAGAGCAGGTCATAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017893
VALIDATED
SEMA4G MISSION shRNA Lentiviral Transduction Particles
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1705s21c1
Sequence:CCGGCCTACCTATGACCTGCTCTTTCTCGAGAAAGAGCAGGTCATAGGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-483s21c1
Sequence:CCGGCCCTCGGATGACCATACCCTACTCGAGTAGGGTATGGTCATCCGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-483s1c1
Sequence:CCGGCCCTCGGATGACCATACCCTACTCGAGTAGGGTATGGTCATCCGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1435s1c1
Sequence:CCGGCCCTATATGGAATACCAGGATCTCGAGATCCTGGTATTCCATATAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1508s1c1
Sequence:CCGGGCTCGTGTATCACAGATTCATCTCGAGATGAATCTGTGATACACGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-2422s1c1
Sequence:CCGGCTGCTCTATGTGCTAGCCATTCTCGAGAATGGCTAGCACATAGAGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1435s21c1
Sequence:CCGGCCCTATATGGAATACCAGGATCTCGAGATCCTGGTATTCCATATAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017893.2-1508s21c1
Sequence:CCGGGCTCGTGTATCACAGATTCATCTCGAGATGAATCTGTGATACACGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017893.2-1705s1c1
Sequence:CCGGCCTACCTATGACCTGCTCTTTCTCGAGAAAGAGCAGGTCATAGGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???