EMAIL THIS PAGE TO A FRIEND

SEMA6C

sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C

83 Gene Product Result for
Synonyms: SEMAY m-SemaY m-SemaY2
Gene ID:
Human(10500) Summary: This gene encodes a member of the semaphorin family. Semaphorins represent important molecular signals controlling multiple aspects of the cellular response that follows CNS injury, and thus may play an important role in neural regeneration. [provided by RefSeq, May 2010]
Mouse(20360) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Rat(29744) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
chicken(100857823) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
domestic cat(101083785) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
dog(483191) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
cow(524464) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
sheep(101111591) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
domestic guinea pig(100731795) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
naked mole-rat(101707121) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Domestic Rabbit(100328662) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030913 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152141 MISSION® esiRNA esiRNA human SEMA6C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030913 Rosetta Predictions human pricing
NM_017308 Rosetta Predictions rat pricing
NM_011351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230839 predicted 969
2 SASI_Hs01_00230840 predicted 646
3 SASI_Hs02_00358451 predicted 451
4 SASI_Hs01_00230841 predicted 664
5 SASI_Hs01_00230842 predicted 546
6 SASI_Hs01_00230844 predicted 1902
7 SASI_Hs01_00230846 predicted 493
8 SASI_Hs02_00358452 predicted 391
9 SASI_Hs02_00358453 predicted 1767
10 SASI_Hs01_00230848 predicted 1599
11 SASI_Hs01_00230843 predicted 486
12 SASI_Hs01_00230845 predicted 872
13 SASI_Hs01_00230847 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052858 predicted 909
2 SASI_Rn01_00052859 predicted 3010
3 SASI_Rn01_00052860 predicted 693
4 SASI_Rn01_00052861 predicted 1257
5 SASI_Rn01_00052863 predicted 391
6 SASI_Rn01_00052864 predicted 1773
7 SASI_Rn01_00052865 predicted 926
8 SASI_Rn01_00052866 predicted 603
9 SASI_Rn01_00052867 predicted 1683
10 SASI_Rn02_00261755 predicted 567
11 SASI_Rn01_00052862 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320497 predicted 422
2 SASI_Mm02_00320498 predicted 1011
3 SASI_Mm01_00155397 predicted 438
4 SASI_Mm01_00155398 predicted 894
5 SASI_Mm01_00155400 predicted 467
6 SASI_Mm01_00155401 predicted 370
7 SASI_Mm01_00155402 predicted 200
8 SASI_Mm01_00155404 predicted 1250
9 SASI_Mm02_00320499 predicted 926
10 SASI_Mm02_00320500 predicted 224
11 SASI_Mm01_00155396 predicted 1814
12 SASI_Mm01_00155399 predicted 1396
13 SASI_Mm01_00155403 predicted 394
14 SASI_Mm01_00155405 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011351
SEMA6C MISSION shRNA Bacterial Glycerol Stock
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1540s1c1
Sequence:CCGGCTTTCCTGGATGTATCGTCTACTCGAGTAGACGATACATCCAGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1019s1c1
Sequence:CCGGGCCTTCTACCTAGATGATATTCTCGAGAATATCATCTAGGTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-1646s21c1
Sequence:CCGGTCCAGAGGCTGCATGAGTATCCTCGAGGATACTCATGCAGCCTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-799s1c1
Sequence:CCGGCCGGGTATGTAAACGTGACATCTCGAGATGTCACGTTTACATACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-691s1c1
Sequence:CCGGGCCACACTTTGTCTATGCGTTCTCGAGAACGCATAGACAAAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1017s1c1
Sequence:CCGGGCGCCTTCTACCTAGATGATACTCGAGTATCATCTAGGTAGAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-651s21c1
Sequence:CCGGCACTCCGTTCTGCAAAGTATGCTCGAGCATACTTTGCAGAACGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-903s21c1
Sequence:CCGGCCTTCTACTTTGACGTCTTACCTCGAGGTAAGACGTCAAAGTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-325s21c1
Sequence:CCGGGACATGGAGGAGTCAAGATATCTCGAGATATCTTGACTCCTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-428s21c1
Sequence:CCGGCTTCTTGCCTGTGGAACAAATCTCGAGATTTGTTCCACAGGCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011351
SEMA6C MISSION shRNA shRNA Plasmid DNA
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1540s1c1
Sequence:CCGGCTTTCCTGGATGTATCGTCTACTCGAGTAGACGATACATCCAGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1019s1c1
Sequence:CCGGGCCTTCTACCTAGATGATATTCTCGAGAATATCATCTAGGTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-1646s21c1
Sequence:CCGGTCCAGAGGCTGCATGAGTATCCTCGAGGATACTCATGCAGCCTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-799s1c1
Sequence:CCGGCCGGGTATGTAAACGTGACATCTCGAGATGTCACGTTTACATACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-691s1c1
Sequence:CCGGGCCACACTTTGTCTATGCGTTCTCGAGAACGCATAGACAAAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1017s1c1
Sequence:CCGGGCGCCTTCTACCTAGATGATACTCGAGTATCATCTAGGTAGAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-651s21c1
Sequence:CCGGCACTCCGTTCTGCAAAGTATGCTCGAGCATACTTTGCAGAACGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-903s21c1
Sequence:CCGGCCTTCTACTTTGACGTCTTACCTCGAGGTAAGACGTCAAAGTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-325s21c1
Sequence:CCGGGACATGGAGGAGTCAAGATATCTCGAGATATCTTGACTCCTCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-428s21c1
Sequence:CCGGCTTCTTGCCTGTGGAACAAATCTCGAGATTTGTTCCACAGGCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011351
SEMA6C MISSION shRNA Lentiviral Transduction Particles
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1540s1c1
Sequence:CCGGCTTTCCTGGATGTATCGTCTACTCGAGTAGACGATACATCCAGGAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1019s1c1
Sequence:CCGGGCCTTCTACCTAGATGATATTCTCGAGAATATCATCTAGGTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-1646s21c1
Sequence:CCGGTCCAGAGGCTGCATGAGTATCCTCGAGGATACTCATGCAGCCTCTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-799s1c1
Sequence:CCGGCCGGGTATGTAAACGTGACATCTCGAGATGTCACGTTTACATACCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-691s1c1
Sequence:CCGGGCCACACTTTGTCTATGCGTTCTCGAGAACGCATAGACAAAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011351.1-1017s1c1
Sequence:CCGGGCGCCTTCTACCTAGATGATACTCGAGTATCATCTAGGTAGAAGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-651s21c1
Sequence:CCGGCACTCCGTTCTGCAAAGTATGCTCGAGCATACTTTGCAGAACGGAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-903s21c1
Sequence:CCGGCCTTCTACTTTGACGTCTTACCTCGAGGTAAGACGTCAAAGTAGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-325s21c1
Sequence:CCGGGACATGGAGGAGTCAAGATATCTCGAGATATCTTGACTCCTCCATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011351.1-428s21c1
Sequence:CCGGCTTCTTGCCTGTGGAACAAATCTCGAGATTTGTTCCACAGGCAAGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030913
SEMA6C MISSION shRNA Bacterial Glycerol Stock
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030913.2-3120s1c1
Sequence:CCGGCGCCTCGGGTTTATTTATTGACTCGAGTCAATAAATAAACCCGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-504s1c1
Sequence:CCGGGATGTGGAGAACTGTGCTGTACTCGAGTACAGCACAGTTCTCCACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-962s1c1
Sequence:CCGGCCGAGTATGTAAACGTGACATCTCGAGATGTCACGTTTACATACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-780s1c1
Sequence:CCGGGCTGTAGTTTACAGAAGCCTTCTCGAGAAGGCTTCTGTAAACTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-2345s1c1
Sequence:CCGGGTGGAACCAGAACAGGAACAACTCGAGTTGTTCCTGTTCTGGTTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-1254s21c1
Sequence:CCGGCTTCACCACCCAGACCAATAGCTCGAGCTATTGGTCTGGGTGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030913.3-3306s21c1
Sequence:CCGGTCCTCAGTGAGCCAGCATTTCCTCGAGGAAATGCTGGCTCACTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-824s21c1
Sequence:CCGGAGTCCAACGTGGCCATCTTTGCTCGAGCAAAGATGGCCACGTTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-656s21c1
Sequence:CCGGATGAGTGCTACAACTATATTCCTCGAGGAATATAGTTGTAGCACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030913
SEMA6C MISSION shRNA shRNA Plasmid DNA
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030913.2-3120s1c1
Sequence:CCGGCGCCTCGGGTTTATTTATTGACTCGAGTCAATAAATAAACCCGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-504s1c1
Sequence:CCGGGATGTGGAGAACTGTGCTGTACTCGAGTACAGCACAGTTCTCCACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-962s1c1
Sequence:CCGGCCGAGTATGTAAACGTGACATCTCGAGATGTCACGTTTACATACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-780s1c1
Sequence:CCGGGCTGTAGTTTACAGAAGCCTTCTCGAGAAGGCTTCTGTAAACTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-2345s1c1
Sequence:CCGGGTGGAACCAGAACAGGAACAACTCGAGTTGTTCCTGTTCTGGTTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-1254s21c1
Sequence:CCGGCTTCACCACCCAGACCAATAGCTCGAGCTATTGGTCTGGGTGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030913.3-3306s21c1
Sequence:CCGGTCCTCAGTGAGCCAGCATTTCCTCGAGGAAATGCTGGCTCACTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-824s21c1
Sequence:CCGGAGTCCAACGTGGCCATCTTTGCTCGAGCAAAGATGGCCACGTTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-656s21c1
Sequence:CCGGATGAGTGCTACAACTATATTCCTCGAGGAATATAGTTGTAGCACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030913
SEMA6C MISSION shRNA Lentiviral Transduction Particles
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030913.2-3120s1c1
Sequence:CCGGCGCCTCGGGTTTATTTATTGACTCGAGTCAATAAATAAACCCGAGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-504s1c1
Sequence:CCGGGATGTGGAGAACTGTGCTGTACTCGAGTACAGCACAGTTCTCCACATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-962s1c1
Sequence:CCGGCCGAGTATGTAAACGTGACATCTCGAGATGTCACGTTTACATACTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-780s1c1
Sequence:CCGGGCTGTAGTTTACAGAAGCCTTCTCGAGAAGGCTTCTGTAAACTACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030913.2-2345s1c1
Sequence:CCGGGTGGAACCAGAACAGGAACAACTCGAGTTGTTCCTGTTCTGGTTCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-1254s21c1
Sequence:CCGGCTTCACCACCCAGACCAATAGCTCGAGCTATTGGTCTGGGTGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030913.3-3306s21c1
Sequence:CCGGTCCTCAGTGAGCCAGCATTTCCTCGAGGAAATGCTGGCTCACTGAGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-824s21c1
Sequence:CCGGAGTCCAACGTGGCCATCTTTGCTCGAGCAAAGATGGCCACGTTGGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030913.3-656s21c1
Sequence:CCGGATGAGTGCTACAACTATATTCCTCGAGGAATATAGTTGTAGCACTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)