EMAIL THIS PAGE TO A FRIEND

SEMA6D

sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D

363 Gene Product Result for
Gene ID:
Human(80031) Summary: Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
Mouse(214968) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Rat(311384) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Domestic Rabbit(100353114) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
naked mole-rat(101723276) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
domestic guinea pig(100715046) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
cow(518458) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
sheep(101112064) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Zebrafish(406272) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Horse(100055875) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
domestic cat(101100893) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
dog(478291) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
chicken(415430) sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020858 Rosetta Predictions human pricing
NM_024966 Rosetta Predictions human pricing
NM_153616 Rosetta Predictions human pricing
NM_153617 Rosetta Predictions human pricing
NM_153618 Rosetta Predictions human pricing
NM_153619 Rosetta Predictions human pricing
NM_001107768 Rosetta Predictions rat pricing
NM_172537 Rosetta Predictions mouse pricing
NM_199238 Rosetta Predictions mouse pricing
NM_199239 Rosetta Predictions mouse pricing
NM_199240 Rosetta Predictions mouse pricing
NM_199241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104948 predicted 1328
2 SASI_Hs01_00104950 predicted 497
3 SASI_Hs01_00104951 predicted 852
4 SASI_Hs01_00104952 predicted 1454
5 SASI_Hs01_00104953 predicted 1582
6 SASI_Hs01_00104954 predicted 1585
7 SASI_Hs01_00104955 predicted 933
8 SASI_Hs01_00104957 predicted 792
9 SASI_Hs02_00354125 predicted 460
10 SASI_Hs02_00354126 predicted 481
11 SASI_Hs01_00104949 predicted 918
12 SASI_Hs01_00104956 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166088 predicted 1330
2 SASI_Hs01_00166090 predicted 499
3 SASI_Hs01_00166091 predicted 850
4 SASI_Hs01_00166092 predicted 1451
5 SASI_Hs01_00166093 predicted 1579
6 SASI_Hs01_00166094 predicted 1582
7 SASI_Hs01_00166095 predicted 932
8 SASI_Hs01_00166097 predicted 784
9 SASI_Hs02_00357630 predicted 461
10 SASI_Hs02_00357631 predicted 478
11 SASI_Hs01_00166089 predicted 916
12 SASI_Hs01_00166096 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045858 predicted 1331
2 SASI_Hs01_00045860 predicted 494
3 SASI_Hs01_00045861 predicted 855
4 SASI_Hs01_00045862 predicted 1452
5 SASI_Hs01_00045863 predicted 1579
6 SASI_Hs01_00045864 predicted 1579
7 SASI_Hs01_00045865 predicted 935
8 SASI_Hs01_00045867 predicted 788
9 SASI_Hs02_00367360 predicted 457
10 SASI_Hs02_00367361 predicted 482
11 SASI_Hs01_00045859 predicted 910
12 SASI_Hs01_00045866 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242668 predicted 1331
2 SASI_Hs01_00242670 predicted 501
3 SASI_Hs01_00242671 predicted 853
4 SASI_Hs01_00242672 predicted 1457
5 SASI_Hs01_00242673 predicted 1579
6 SASI_Hs01_00242674 predicted 1583
7 SASI_Hs01_00242675 predicted 932
8 SASI_Hs01_00242677 predicted 786
9 SASI_Hs02_00367362 predicted 455
10 SASI_Hs02_00367363 predicted 478
11 SASI_Hs01_00242669 predicted 916
12 SASI_Hs01_00242676 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145248 predicted 1324
2 SASI_Hs01_00145250 predicted 501
3 SASI_Hs01_00145251 predicted 856
4 SASI_Hs01_00145252 predicted 1458
5 SASI_Hs01_00145253 predicted 1582
6 SASI_Hs01_00145254 predicted 1580
7 SASI_Hs01_00145255 predicted 932
8 SASI_Hs01_00145257 predicted 789
9 SASI_Hs02_00367364 predicted 460
10 SASI_Hs02_00367365 predicted 483
11 SASI_Hs01_00145249 predicted 916
12 SASI_Hs01_00145256 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177677 predicted 1323
2 SASI_Hs01_00177679 predicted 499
3 SASI_Hs01_00177680 predicted 850
4 SASI_Hs01_00177681 predicted 1457
5 SASI_Hs01_00177682 predicted 1576
6 SASI_Hs01_00177683 predicted 1578
7 SASI_Hs01_00177684 predicted 931
8 SASI_Hs01_00177686 predicted 785
9 SASI_Hs02_00367366 predicted 452
10 SASI_Hs02_00367367 predicted 480
11 SASI_Hs01_00177678 predicted 909
12 SASI_Hs01_00177685 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232075 predicted 1414
2 SASI_Rn02_00232076 predicted 3538
3 SASI_Rn02_00232077 predicted 1319
4 SASI_Rn02_00232078 predicted 964
5 SASI_Rn02_00232079 predicted 3446
6 SASI_Rn02_00232080 predicted 2348
7 SASI_Rn02_00232081 predicted 1658
8 SASI_Rn02_00232082 predicted 3358
9 SASI_Rn02_00232083 predicted 2593
10 SASI_Rn02_00232084 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131499 predicted 1476
2 SASI_Mm01_00131500 predicted 1379
3 SASI_Mm01_00131501 predicted 1720
4 SASI_Mm01_00131502 predicted 1248
5 SASI_Mm02_00344145 predicted 3264
6 SASI_Mm01_00131503 predicted 1942
7 SASI_Mm01_00131505 predicted 1711
8 SASI_Mm01_00131506 predicted 2055
9 SASI_Mm02_00344146 predicted 3286
10 SASI_Mm02_00344147 predicted 3257
11 SASI_Mm01_00131497 predicted 1811
12 SASI_Mm01_00131498 predicted 3491
13 SASI_Mm01_00131504 predicted 2820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122715 predicted 652
2 SASI_Mm01_00122716 predicted 564
3 SASI_Mm01_00122717 predicted 892
4 SASI_Mm01_00122718 predicted 431
5 SASI_Mm02_00351403 predicted 2407
6 SASI_Mm01_00122719 predicted 1127
7 SASI_Mm01_00122721 predicted 891
8 SASI_Mm01_00122722 predicted 1232
9 SASI_Mm02_00351404 predicted 2430
10 SASI_Mm02_00351405 predicted 2394
11 SASI_Mm01_00122713 predicted 992
12 SASI_Mm01_00122714 predicted 2632
13 SASI_Mm01_00122720 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178221 predicted 655
2 SASI_Mm01_00178222 predicted 563
3 SASI_Mm01_00178223 predicted 896
4 SASI_Mm01_00178224 predicted 427
5 SASI_Mm02_00351406 predicted 2494
6 SASI_Mm01_00178225 predicted 1130
7 SASI_Mm01_00178227 predicted 894
8 SASI_Mm01_00178228 predicted 1237
9 SASI_Mm02_00351407 predicted 2526
10 SASI_Mm02_00351408 predicted 2495
11 SASI_Mm01_00178219 predicted 987
12 SASI_Mm01_00178220 predicted 2727
13 SASI_Mm01_00178226 predicted 2061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112698 predicted 652
2 SASI_Mm01_00112699 predicted 558
3 SASI_Mm01_00112700 predicted 899
4 SASI_Mm01_00112701 predicted 430
5 SASI_Mm02_00351409 predicted 2569
6 SASI_Mm01_00112702 predicted 1129
7 SASI_Mm01_00112704 predicted 893
8 SASI_Mm01_00112705 predicted 1231
9 SASI_Mm02_00351410 predicted 2589
10 SASI_Mm02_00351411 predicted 2564
11 SASI_Mm01_00112696 predicted 993
12 SASI_Mm01_00112697 predicted 2804
13 SASI_Mm01_00112703 predicted 2128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072851 predicted 652
2 SASI_Mm01_00072852 predicted 565
3 SASI_Mm01_00072853 predicted 897
4 SASI_Mm01_00072854 predicted 426
5 SASI_Mm02_00351412 predicted 2631
6 SASI_Mm01_00072855 predicted 1127
7 SASI_Mm01_00072857 predicted 886
8 SASI_Mm01_00072858 predicted 1233
9 SASI_Mm02_00351413 predicted 2651
10 SASI_Mm02_00351414 predicted 2623
11 SASI_Mm01_00072849 predicted 987
12 SASI_Mm01_00072850 predicted 2857
13 SASI_Mm01_00072856 predicted 2187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172537
SEMA6D MISSION shRNA Bacterial Glycerol Stock
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172537.3-1432s21c1
Sequence:CCGGGGATCTGCCCTTCGCACAATACTCGAGTATTGTGCGAAGGGCAGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172537.2-4427s1c1
Sequence:CCGGGCCACCAACAAACTATGTTAACTCGAGTTAACATAGTTTGTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-914s1c1
Sequence:CCGGCGGTTGACTATCACTATTCAACTCGAGTTGAATAGTGATAGTCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-2877s1c1
Sequence:CCGGGCCACCAAACACGGATACAAACTCGAGTTTGTATCCGTGTTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-1495s1c1
Sequence:CCGGGCCATAGAATATGGAAACTATCTCGAGATAGTTTCCATATTCTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-1710s1c1
Sequence:CCGGGCAGTCTATAACAGACATAATCTCGAGATTATGTCTGTTATAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172537.3-2365s21c1
Sequence:CCGGGAGCGCTACGGATCGTGTAAACTCGAGTTTACACGATCCGTAGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172537
SEMA6D MISSION shRNA shRNA Plasmid DNA
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172537.3-1432s21c1
Sequence:CCGGGGATCTGCCCTTCGCACAATACTCGAGTATTGTGCGAAGGGCAGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172537.2-4427s1c1
Sequence:CCGGGCCACCAACAAACTATGTTAACTCGAGTTAACATAGTTTGTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-914s1c1
Sequence:CCGGCGGTTGACTATCACTATTCAACTCGAGTTGAATAGTGATAGTCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-2877s1c1
Sequence:CCGGGCCACCAAACACGGATACAAACTCGAGTTTGTATCCGTGTTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-1495s1c1
Sequence:CCGGGCCATAGAATATGGAAACTATCTCGAGATAGTTTCCATATTCTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-1710s1c1
Sequence:CCGGGCAGTCTATAACAGACATAATCTCGAGATTATGTCTGTTATAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172537.3-2365s21c1
Sequence:CCGGGAGCGCTACGGATCGTGTAAACTCGAGTTTACACGATCCGTAGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172537
SEMA6D MISSION shRNA Lentiviral Transduction Particles
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172537.3-1432s21c1
Sequence:CCGGGGATCTGCCCTTCGCACAATACTCGAGTATTGTGCGAAGGGCAGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172537.2-4427s1c1
Sequence:CCGGGCCACCAACAAACTATGTTAACTCGAGTTAACATAGTTTGTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-914s1c1
Sequence:CCGGCGGTTGACTATCACTATTCAACTCGAGTTGAATAGTGATAGTCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-2877s1c1
Sequence:CCGGGCCACCAAACACGGATACAAACTCGAGTTTGTATCCGTGTTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-1495s1c1
Sequence:CCGGGCCATAGAATATGGAAACTATCTCGAGATAGTTTCCATATTCTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172537.2-1710s1c1
Sequence:CCGGGCAGTCTATAACAGACATAATCTCGAGATTATGTCTGTTATAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172537.3-2365s21c1
Sequence:CCGGGAGCGCTACGGATCGTGTAAACTCGAGTTTACACGATCCGTAGCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020858
SEMA6D MISSION shRNA Bacterial Glycerol Stock
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-792s1c1
Sequence:CCGGGCCACAACTTTATCAAAGTATCTCGAGATACTTTGATAAAGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-936s1c1
Sequence:CCGGGCCCATTTGATGCCAGACAAACTCGAGTTTGTCTGGCATCAAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-2396s1c1
Sequence:CCGGGCCAAACTGAATGGTCTCTTTCTCGAGAAAGAGACCATTCAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-1330s1c1
Sequence:CCGGGCAGTCTATTACAGACATAATCTCGAGATTATGTCTGTAATAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-1594s1c1
Sequence:CCGGCCCGGATGAAACTCTGTCATTCTCGAGAATGACAGAGTTTCATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020858
SEMA6D MISSION shRNA shRNA Plasmid DNA
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-792s1c1
Sequence:CCGGGCCACAACTTTATCAAAGTATCTCGAGATACTTTGATAAAGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-936s1c1
Sequence:CCGGGCCCATTTGATGCCAGACAAACTCGAGTTTGTCTGGCATCAAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-2396s1c1
Sequence:CCGGGCCAAACTGAATGGTCTCTTTCTCGAGAAAGAGACCATTCAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-1330s1c1
Sequence:CCGGGCAGTCTATTACAGACATAATCTCGAGATTATGTCTGTAATAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-1594s1c1
Sequence:CCGGCCCGGATGAAACTCTGTCATTCTCGAGAATGACAGAGTTTCATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020858
SEMA6D MISSION shRNA Lentiviral Transduction Particles
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-792s1c1
Sequence:CCGGGCCACAACTTTATCAAAGTATCTCGAGATACTTTGATAAAGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-936s1c1
Sequence:CCGGGCCCATTTGATGCCAGACAAACTCGAGTTTGTCTGGCATCAAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-2396s1c1
Sequence:CCGGGCCAAACTGAATGGTCTCTTTCTCGAGAAAGAGACCATTCAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-1330s1c1
Sequence:CCGGGCAGTCTATTACAGACATAATCTCGAGATTATGTCTGTAATAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020858.1-1594s1c1
Sequence:CCGGCCCGGATGAAACTCTGTCATTCTCGAGAATGACAGAGTTTCATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)