EMAIL THIS PAGE TO A FRIEND

SEPT10

septin 10

92 Gene Product Result for
UniProtKB ID: Q9P0V9, B3KRQ9, Q86VP5, Q9HAH6
Gene ID:
Human(151011) Summary: This gene encodes a member of the septin family of cytoskeletal proteins with GTPase activity. This protein localizes to the cytoplasm and nucleus and displays GTP-binding and GTPase activity. A pseudogene for this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Mouse(103080) septin 10
Rat(309891) septin 10
Zebrafish(550129) septin 10
chicken(418732) septin 10
dog(100688206) septin 10
cow(514603) septin 10
sheep(101109873) septin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144710 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085101 MISSION® esiRNA esiRNA human SEPT10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144710 Rosetta Predictions human pricing
NM_178584 Rosetta Predictions human pricing
NM_001014033 Rosetta Predictions rat pricing
NM_001024910 Rosetta Predictions mouse pricing
NM_001024911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087768 predicted 1133
2 SASI_Hs01_00087769 predicted 737
3 SASI_Hs01_00087770 predicted 974
4 SASI_Hs01_00087772 predicted 1150
5 SASI_Hs01_00087773 predicted 1338
6 SASI_Hs01_00087774 predicted 717
7 SASI_Hs01_00087775 predicted 823
8 SASI_Hs01_00087776 predicted 1093
9 SASI_Hs01_00087771 predicted 1158
10 SASI_Hs02_00364649 predicted 678
11 SASI_Hs01_00087777 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179530 predicted 1066
2 SASI_Hs01_00179531 predicted 666
3 SASI_Hs01_00179532 predicted 910
4 SASI_Hs01_00179534 predicted 1080
5 SASI_Hs01_00179535 predicted 1261
6 SASI_Hs01_00179536 predicted 648
7 SASI_Hs01_00179537 predicted 753
8 SASI_Hs01_00179538 predicted 1023
9 SASI_Hs01_00179533 predicted 1091
10 SASI_Hs02_00369838 predicted 953
11 SASI_Hs01_00179539 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092675 predicted 451
2 SASI_Rn01_00092676 predicted 1207
3 SASI_Rn01_00092677 predicted 973
4 SASI_Rn01_00092678 predicted 1137
5 SASI_Rn01_00092679 predicted 1203
6 SASI_Rn02_00201416 predicted 719
7 SASI_Rn01_00092681 predicted 379
8 SASI_Rn01_00092682 predicted 349
9 SASI_Rn02_00201417 predicted 392
10 SASI_Rn01_00092684 predicted 796
11 SASI_Rn01_00092680 predicted 729
12 SASI_Rn01_00092683 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134511 predicted 1041
2 SASI_Mm01_00134513 predicted 1410
3 SASI_Mm01_00134514 predicted 1113
4 SASI_Mm01_00134515 predicted 1340
5 SASI_Mm02_00287735 predicted 1446
6 SASI_Mm01_00134516 predicted 1379
7 SASI_Mm01_00134517 predicted 1297
8 SASI_Mm01_00134518 predicted 1128
9 SASI_Mm01_00134519 predicted 1085
10 SASI_Mm01_00134520 predicted 1139
11 SASI_Mm01_00134512 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179401 predicted 659
2 SASI_Mm01_00179403 predicted 1022
3 SASI_Mm01_00179404 predicted 735
4 SASI_Mm01_00179405 predicted 951
5 SASI_Mm02_00287736 predicted 1061
6 SASI_Mm01_00179406 predicted 990
7 SASI_Mm01_00179407 predicted 906
8 SASI_Mm01_00179408 predicted 740
9 SASI_Mm01_00179409 predicted 701
10 SASI_Mm01_00179410 predicted 751
11 SASI_Mm01_00179402 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024911
VALIDATED
SEPT10 MISSION shRNA Bacterial Glycerol Stock
septin 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-1294s21c1
Sequence:CCGGGCAGACACATATGAGGCACTACTCGAGTAGTGCCTCATATGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024911.2-1796s21c1
Sequence:CCGGGCCTTATCAGTAACTCAGTTACTCGAGTAACTGAGTTACTGATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-982s21c1
Sequence:CCGGCAAGGCAGATACAATTTCTAACTCGAGTTAGAAATTGTATCTGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-596s1c1
Sequence:CCGGCAAGGCAGATACAATTTCTAACTCGAGTTAGAAATTGTATCTGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-1410s1c1
Sequence:CCGGGCCTTATCAGTAACTCAGTTACTCGAGTAACTGAGTTACTGATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-908s1c1
Sequence:CCGGGCAGACACATATGAGGCACTACTCGAGTAGTGCCTCATATGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-710s1c1
Sequence:CCGGCTCCAAGATCAATGGAGCAATCTCGAGATTGCTCCATTGATCTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-1089s21c1
Sequence:CCGGACACGACCTCCAAGATCAATGCTCGAGCATTGATCTTGGAGGTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024911
VALIDATED
SEPT10 MISSION shRNA shRNA Plasmid DNA
septin 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-1294s21c1
Sequence:CCGGGCAGACACATATGAGGCACTACTCGAGTAGTGCCTCATATGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024911.2-1796s21c1
Sequence:CCGGGCCTTATCAGTAACTCAGTTACTCGAGTAACTGAGTTACTGATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-982s21c1
Sequence:CCGGCAAGGCAGATACAATTTCTAACTCGAGTTAGAAATTGTATCTGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-596s1c1
Sequence:CCGGCAAGGCAGATACAATTTCTAACTCGAGTTAGAAATTGTATCTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-1410s1c1
Sequence:CCGGGCCTTATCAGTAACTCAGTTACTCGAGTAACTGAGTTACTGATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-908s1c1
Sequence:CCGGGCAGACACATATGAGGCACTACTCGAGTAGTGCCTCATATGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-710s1c1
Sequence:CCGGCTCCAAGATCAATGGAGCAATCTCGAGATTGCTCCATTGATCTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-1089s21c1
Sequence:CCGGACACGACCTCCAAGATCAATGCTCGAGCATTGATCTTGGAGGTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024911
VALIDATED
SEPT10 MISSION shRNA Lentiviral Transduction Particles
septin 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-1294s21c1
Sequence:CCGGGCAGACACATATGAGGCACTACTCGAGTAGTGCCTCATATGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024911.2-1796s21c1
Sequence:CCGGGCCTTATCAGTAACTCAGTTACTCGAGTAACTGAGTTACTGATAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-982s21c1
Sequence:CCGGCAAGGCAGATACAATTTCTAACTCGAGTTAGAAATTGTATCTGCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-596s1c1
Sequence:CCGGCAAGGCAGATACAATTTCTAACTCGAGTTAGAAATTGTATCTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-1410s1c1
Sequence:CCGGGCCTTATCAGTAACTCAGTTACTCGAGTAACTGAGTTACTGATAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-908s1c1
Sequence:CCGGGCAGACACATATGAGGCACTACTCGAGTAGTGCCTCATATGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024911.1-710s1c1
Sequence:CCGGCTCCAAGATCAATGGAGCAATCTCGAGATTGCTCCATTGATCTTGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024911.2-1089s21c1
Sequence:CCGGACACGACCTCCAAGATCAATGCTCGAGCATTGATCTTGGAGGTCGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144710
VALIDATED
SEPT10 MISSION shRNA Bacterial Glycerol Stock
septin 10
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1412s1c1
Sequence:CCGGCAAGAGACCTATGAAGCCAAACTCGAGTTTGGCTTCATAGGTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1002s1c1
Sequence:CCGGCCAAAGCAGATACGGTTTCTACTCGAGTAGAAACCGTATCTGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144710.2-2630s1c1
Sequence:CCGGGCCTTATTATGGCTGACGTATCTCGAGATACGTCAGCCATAATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-964s1c1
Sequence:CCGGGAACCTTGACAGCAAGGTAAACTCGAGTTTACCTTGCTGTCAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_144710.2-1003s1c1
Sequence:CCGGCAAAGCAGATACGGTTTCTAACTCGAGTTAGAAACCGTATCTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1708s1c1
Sequence:CCGGGAAGGACAAGGACCGTAAGAACTCGAGTTCTTACGGTCCTTGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1187s1c1
Sequence:CCGGGTCGGAAACAAGATGGTCAAACTCGAGTTTGACCATCTTGTTTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1054s1c1
Sequence:CCGGCATGAGTGAATTGGTCAGCAACTCGAGTTGCTGACCAATTCACTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-544s1c1
Sequence:CCGGGCTGGTGAACAGATCCATTCACTCGAGTGAATGGATCTGTTCACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1096s1c1
Sequence:CCGGCCCAACGGATGATGACACTATCTCGAGATAGTGTCATCATCCGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1544s1c1
Sequence:CCGGCAGGCCAAATTTGAGCACCTTCTCGAGAAGGTGCTCAAATTTGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144710
VALIDATED
SEPT10 MISSION shRNA shRNA Plasmid DNA
septin 10
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1412s1c1
Sequence:CCGGCAAGAGACCTATGAAGCCAAACTCGAGTTTGGCTTCATAGGTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1002s1c1
Sequence:CCGGCCAAAGCAGATACGGTTTCTACTCGAGTAGAAACCGTATCTGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144710.2-2630s1c1
Sequence:CCGGGCCTTATTATGGCTGACGTATCTCGAGATACGTCAGCCATAATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-964s1c1
Sequence:CCGGGAACCTTGACAGCAAGGTAAACTCGAGTTTACCTTGCTGTCAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_144710.2-1003s1c1
Sequence:CCGGCAAAGCAGATACGGTTTCTAACTCGAGTTAGAAACCGTATCTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1708s1c1
Sequence:CCGGGAAGGACAAGGACCGTAAGAACTCGAGTTCTTACGGTCCTTGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1187s1c1
Sequence:CCGGGTCGGAAACAAGATGGTCAAACTCGAGTTTGACCATCTTGTTTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1054s1c1
Sequence:CCGGCATGAGTGAATTGGTCAGCAACTCGAGTTGCTGACCAATTCACTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-544s1c1
Sequence:CCGGGCTGGTGAACAGATCCATTCACTCGAGTGAATGGATCTGTTCACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1096s1c1
Sequence:CCGGCCCAACGGATGATGACACTATCTCGAGATAGTGTCATCATCCGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1544s1c1
Sequence:CCGGCAGGCCAAATTTGAGCACCTTCTCGAGAAGGTGCTCAAATTTGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144710
VALIDATED
SEPT10 MISSION shRNA Lentiviral Transduction Particles
septin 10
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1412s1c1
Sequence:CCGGCAAGAGACCTATGAAGCCAAACTCGAGTTTGGCTTCATAGGTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1002s1c1
Sequence:CCGGCCAAAGCAGATACGGTTTCTACTCGAGTAGAAACCGTATCTGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144710.2-2630s1c1
Sequence:CCGGGCCTTATTATGGCTGACGTATCTCGAGATACGTCAGCCATAATAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-964s1c1
Sequence:CCGGGAACCTTGACAGCAAGGTAAACTCGAGTTTACCTTGCTGTCAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_144710.2-1003s1c1
Sequence:CCGGCAAAGCAGATACGGTTTCTAACTCGAGTTAGAAACCGTATCTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1708s1c1
Sequence:CCGGGAAGGACAAGGACCGTAAGAACTCGAGTTCTTACGGTCCTTGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1187s1c1
Sequence:CCGGGTCGGAAACAAGATGGTCAAACTCGAGTTTGACCATCTTGTTTCCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1054s1c1
Sequence:CCGGCATGAGTGAATTGGTCAGCAACTCGAGTTGCTGACCAATTCACTCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-544s1c1
Sequence:CCGGGCTGGTGAACAGATCCATTCACTCGAGTGAATGGATCTGTTCACCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1096s1c1
Sequence:CCGGCCCAACGGATGATGACACTATCTCGAGATAGTGTCATCATCCGTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144710.2-1544s1c1
Sequence:CCGGCAGGCCAAATTTGAGCACCTTCTCGAGAAGGTGCTCAAATTTGGCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)