EMAIL THIS PAGE TO A FRIEND

SEPT1

septin 1

45 Gene Product Result for
Synonyms: DIFF6 LARP PNUTL3 SEP1
UniProtKB ID: Q8WYJ6, B4DVE6, Q658T1, Q8NEZ1, Q96EL4, Q9H285
Gene ID:
Human(1731) Summary: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]
Mouse(54204) septin 1
Rat(293507) septin 1
cow(512478) septin 1
sheep(101121228) septin 1
dog(489900) septin 1
Horse(100065662) septin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052838 Rosetta Predictions human pricing
NM_001012460 Rosetta Predictions rat pricing
NM_017461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191714 predicted 669
2 SASI_Hs01_00191715 predicted 947
3 SASI_Hs01_00191716 predicted 288
4 SASI_Hs01_00191717 predicted 658
5 SASI_Hs01_00191718 predicted 515
6 SASI_Hs01_00191719 predicted 644
7 SASI_Hs01_00191720 predicted 1169
8 SASI_Hs01_00191721 predicted 657
9 SASI_Hs01_00191722 predicted 1102
10 SASI_Hs01_00191723 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035251 predicted 419
2 SASI_Rn01_00035252 predicted 1018
3 SASI_Rn01_00035254 predicted 1150
4 SASI_Rn01_00035255 predicted 1169
5 SASI_Rn01_00035256 predicted 619
6 SASI_Rn01_00035257 predicted 279
7 SASI_Rn01_00035258 predicted 805
8 SASI_Rn01_00035259 predicted 634
9 SASI_Rn02_00200554 predicted 229
10 SASI_Rn02_00200555 predicted 1185
11 SASI_Rn01_00035253 predicted 1130
12 SASI_Rn01_00035260 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136984 predicted 408
2 SASI_Mm01_00136985 predicted 793
3 SASI_Mm01_00136986 predicted 841
4 SASI_Mm01_00136987 predicted 609
5 SASI_Mm01_00136988 predicted 387
6 SASI_Mm01_00136989 predicted 712
7 SASI_Mm01_00136990 predicted 266
8 SASI_Mm02_00323924 predicted 800
9 SASI_Mm01_00136992 predicted 520
10 SASI_Mm01_00136993 predicted 990
11 SASI_Mm01_00136991 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052838
SEPT1 MISSION shRNA Bacterial Glycerol Stock
septin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-793s1c1
Sequence:CCGGCGAATGTGACTCTGATGAAGACTCGAGTCTTCATCAGAGTCACATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-1216s1c1
Sequence:CCGGGCAAGAGATGCTGGAGAAGATCTCGAGATCTTCTCCAGCATCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-521s1c1
Sequence:CCGGGAGCAATTTGAGCAGTACCTTCTCGAGAAGGTACTGCTCAAATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-952s1c1
Sequence:CCGGGAACCCACATCACTGCGATTTCTCGAGAAATCGCAGTGATGTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-326s1c1
Sequence:CCGGCTCACCAACCTCTATGAGGATCTCGAGATCCTCATAGAGGTTGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-256s1c1
Sequence:CCGGGTTTGACTTCACGCTAATGGTCTCGAGACCATTAGCGTGAAGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-841s1c1
Sequence:CCGGGATGAAGGAAAGCATCCCTTTCTCGAGAAAGGGATGCTTTCCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-428s1c1
Sequence:CCGGGTGAAAGTGAAGCTGACCCTTCTCGAGAAGGGTCAGCTTCACTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-598s1c1
Sequence:CCGGCCTCTACTTCATCTCACCCTTCTCGAGAAGGGTGAGATGAAGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052838
SEPT1 MISSION shRNA shRNA Plasmid DNA
septin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-793s1c1
Sequence:CCGGCGAATGTGACTCTGATGAAGACTCGAGTCTTCATCAGAGTCACATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-1216s1c1
Sequence:CCGGGCAAGAGATGCTGGAGAAGATCTCGAGATCTTCTCCAGCATCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-521s1c1
Sequence:CCGGGAGCAATTTGAGCAGTACCTTCTCGAGAAGGTACTGCTCAAATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-952s1c1
Sequence:CCGGGAACCCACATCACTGCGATTTCTCGAGAAATCGCAGTGATGTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-326s1c1
Sequence:CCGGCTCACCAACCTCTATGAGGATCTCGAGATCCTCATAGAGGTTGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-256s1c1
Sequence:CCGGGTTTGACTTCACGCTAATGGTCTCGAGACCATTAGCGTGAAGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-841s1c1
Sequence:CCGGGATGAAGGAAAGCATCCCTTTCTCGAGAAAGGGATGCTTTCCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-428s1c1
Sequence:CCGGGTGAAAGTGAAGCTGACCCTTCTCGAGAAGGGTCAGCTTCACTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-598s1c1
Sequence:CCGGCCTCTACTTCATCTCACCCTTCTCGAGAAGGGTGAGATGAAGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052838
SEPT1 MISSION shRNA Lentiviral Transduction Particles
septin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-793s1c1
Sequence:CCGGCGAATGTGACTCTGATGAAGACTCGAGTCTTCATCAGAGTCACATTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000157464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-1216s1c1
Sequence:CCGGGCAAGAGATGCTGGAGAAGATCTCGAGATCTTCTCCAGCATCTCTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000152609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-521s1c1
Sequence:CCGGGAGCAATTTGAGCAGTACCTTCTCGAGAAGGTACTGCTCAAATTGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-952s1c1
Sequence:CCGGGAACCCACATCACTGCGATTTCTCGAGAAATCGCAGTGATGTGGGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-326s1c1
Sequence:CCGGCTCACCAACCTCTATGAGGATCTCGAGATCCTCATAGAGGTTGGTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000152570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-256s1c1
Sequence:CCGGGTTTGACTTCACGCTAATGGTCTCGAGACCATTAGCGTGAAGTCAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000152987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-841s1c1
Sequence:CCGGGATGAAGGAAAGCATCCCTTTCTCGAGAAAGGGATGCTTTCCTTCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-428s1c1
Sequence:CCGGGTGAAAGTGAAGCTGACCCTTCTCGAGAAGGGTCAGCTTCACTTTCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000157926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052838.2-598s1c1
Sequence:CCGGCCTCTACTTCATCTCACCCTTCTCGAGAAGGGTGAGATGAAGTAGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017461
SEPT1 MISSION shRNA Bacterial Glycerol Stock
septin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-512s1c1
Sequence:CCGGGCAGTGCACGAGAAAGTCAATCTCGAGATTGACTTTCTCGTGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017461.1-1248s1c1
Sequence:CCGGGCCCTTGCACTTAAACCAGATCTCGAGATCTGGTTTAAGTGCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-851s1c1
Sequence:CCGGACCCACCTTCAGGACTTGAAACTCGAGTTTCAAGTCCTGAAGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-365s1c1
Sequence:CCGGCGCTTCATTGAGGAGCAGTTTCTCGAGAAACTGCTCCTCAATGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-593s21c1
Sequence:CCGGAGATCCGGGACCAGTTGAAAGCTCGAGCTTTCAACTGGTCCCGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-455s1c1
Sequence:CCGGCTCTACTTCATCTCACCCTTTCTCGAGAAAGGGTGAGATGAAGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017461.2-1266s21c1
Sequence:CCGGCCTCCAATCCGGAAGTTTAAGCTCGAGCTTAAACTTCCGGATTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-1122s21c1
Sequence:CCGGATCAGATGTGCTGTGATATTCCTCGAGGAATATCACAGCACATCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-1029s21c1
Sequence:CCGGGATTCGCGAGAAGGACGAAGACTCGAGTCTTCGTCCTTCTCGCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017461
SEPT1 MISSION shRNA shRNA Plasmid DNA
septin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-512s1c1
Sequence:CCGGGCAGTGCACGAGAAAGTCAATCTCGAGATTGACTTTCTCGTGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017461.1-1248s1c1
Sequence:CCGGGCCCTTGCACTTAAACCAGATCTCGAGATCTGGTTTAAGTGCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-851s1c1
Sequence:CCGGACCCACCTTCAGGACTTGAAACTCGAGTTTCAAGTCCTGAAGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-365s1c1
Sequence:CCGGCGCTTCATTGAGGAGCAGTTTCTCGAGAAACTGCTCCTCAATGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-593s21c1
Sequence:CCGGAGATCCGGGACCAGTTGAAAGCTCGAGCTTTCAACTGGTCCCGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-455s1c1
Sequence:CCGGCTCTACTTCATCTCACCCTTTCTCGAGAAAGGGTGAGATGAAGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017461.2-1266s21c1
Sequence:CCGGCCTCCAATCCGGAAGTTTAAGCTCGAGCTTAAACTTCCGGATTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-1122s21c1
Sequence:CCGGATCAGATGTGCTGTGATATTCCTCGAGGAATATCACAGCACATCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-1029s21c1
Sequence:CCGGGATTCGCGAGAAGGACGAAGACTCGAGTCTTCGTCCTTCTCGCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017461
SEPT1 MISSION shRNA Lentiviral Transduction Particles
septin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-512s1c1
Sequence:CCGGGCAGTGCACGAGAAAGTCAATCTCGAGATTGACTTTCTCGTGCACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017461.1-1248s1c1
Sequence:CCGGGCCCTTGCACTTAAACCAGATCTCGAGATCTGGTTTAAGTGCAAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-851s1c1
Sequence:CCGGACCCACCTTCAGGACTTGAAACTCGAGTTTCAAGTCCTGAAGGTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-365s1c1
Sequence:CCGGCGCTTCATTGAGGAGCAGTTTCTCGAGAAACTGCTCCTCAATGAAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-593s21c1
Sequence:CCGGAGATCCGGGACCAGTTGAAAGCTCGAGCTTTCAACTGGTCCCGGATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017461.1-455s1c1
Sequence:CCGGCTCTACTTCATCTCACCCTTTCTCGAGAAAGGGTGAGATGAAGTAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017461.2-1266s21c1
Sequence:CCGGCCTCCAATCCGGAAGTTTAAGCTCGAGCTTAAACTTCCGGATTGGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-1122s21c1
Sequence:CCGGATCAGATGTGCTGTGATATTCCTCGAGGAATATCACAGCACATCTGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017461.2-1029s21c1
Sequence:CCGGGATTCGCGAGAAGGACGAAGACTCGAGTCTTCGTCCTTCTCGCGAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???