EMAIL THIS PAGE TO A FRIEND

SEPT2

septin 2

85 Gene Product Result for
Synonyms: DIFF6 NEDD5 Pnutl3 hNedd5
UniProtKB ID: Q15019, B4DGE8, Q14132, Q53QU3, Q8IUK9, Q96CB0
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008491 Rosetta Predictions human pricing
NM_001008492 Rosetta Predictions human pricing
NM_004404 Rosetta Predictions human pricing
NM_006155 Rosetta Predictions human pricing
NM_057148 Rosetta Predictions rat pricing
NM_010891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305472 predicted 1351
2 SASI_Hs01_00176471 predicted 905
3 SASI_Hs01_00176472 predicted 921
4 SASI_Hs01_00176475 predicted 895
5 SASI_Hs01_00176476 predicted 1508
6 SASI_Hs01_00176477 predicted 820
7 SASI_Hs01_00176478 predicted 1050
8 SASI_Hs01_00176479 predicted 1092
9 SASI_Hs02_00305473 predicted 1502
10 SASI_Hs02_00305474 predicted 1574
11 SASI_Hs01_00176470 predicted 915
12 SASI_Hs01_00176473 predicted 1246
13 SASI_Hs01_00176474 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305475 predicted 1150
2 SASI_Hs01_00150746 predicted 696
3 SASI_Hs01_00150747 predicted 722
4 SASI_Hs01_00150750 predicted 693
5 SASI_Hs01_00150751 predicted 1311
6 SASI_Hs01_00150752 predicted 614
7 SASI_Hs01_00150753 predicted 854
8 SASI_Hs01_00150754 predicted 890
9 SASI_Hs02_00305476 predicted 1297
10 SASI_Hs02_00305477 predicted 1366
11 SASI_Hs01_00150745 predicted 712
12 SASI_Hs01_00150748 predicted 1050
13 SASI_Hs01_00150749 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337533 predicted 1067
2 SASI_Hs01_00054146 predicted 614
3 SASI_Hs01_00054147 predicted 636
4 SASI_Hs01_00054150 predicted 600
5 SASI_Hs01_00054151 predicted 1220
6 SASI_Hs01_00054152 predicted 535
7 SASI_Hs01_00054153 predicted 768
8 SASI_Hs01_00054154 predicted 808
9 SASI_Hs02_00337534 predicted 1212
10 SASI_Hs02_00337535 predicted 1281
11 SASI_Hs01_00054145 predicted 634
12 SASI_Hs01_00054148 predicted 960
13 SASI_Hs01_00054149 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340997 predicted 1254
2 SASI_Hs01_00065836 predicted 799
3 SASI_Hs01_00065837 predicted 824
4 SASI_Hs01_00065840 predicted 789
5 SASI_Hs01_00065841 predicted 1407
6 SASI_Hs01_00065842 predicted 720
7 SASI_Hs01_00065843 predicted 950
8 SASI_Hs01_00065844 predicted 993
9 SASI_Hs02_00340998 predicted 1401
10 SASI_Hs02_00340999 predicted 1471
11 SASI_Hs01_00065835 predicted 820
12 SASI_Hs01_00065838 predicted 1153
13 SASI_Hs01_00065839 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107081 predicted 301
2 SASI_Rn01_00107082 predicted 243
3 SASI_Rn01_00107083 predicted 281
4 SASI_Rn01_00107084 predicted 972
5 SASI_Rn01_00107085 predicted 405
6 SASI_Rn01_00107086 predicted 745
7 SASI_Rn01_00107087 predicted 541
8 SASI_Rn01_00107088 predicted 215
9 SASI_Rn01_00107089 predicted 994
10 SASI_Rn01_00107090 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149911 predicted 286
2 SASI_Mm01_00149912 predicted 412
3 SASI_Mm02_00319595 predicted 432
4 SASI_Mm01_00149913 predicted 644
5 SASI_Mm01_00149914 predicted 876
6 SASI_Mm01_00149917 predicted 471
7 SASI_Mm02_00319596 predicted 831
8 SASI_Mm02_00319597 predicted 865
9 SASI_Mm01_00149919 predicted 685
10 SASI_Mm01_00149920 predicted 219
11 SASI_Mm01_00149915 predicted 235
12 SASI_Mm01_00149916 predicted 991
13 SASI_Mm01_00149918 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004404
VALIDATED
SEPT2 MISSION shRNA Bacterial Glycerol Stock
septin 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-848s21c1
Sequence:CCGGTGTGGTTGGATCCAATCAGTTCTCGAGAACTGATTGGATCCAACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-547s21c1
Sequence:CCGGGGCGGCACATCATTGATAATACTCGAGTATTATCAATGATGTGCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004404.3-1592s21c1
Sequence:CCGGATCTAGAACATTCAGATTTACCTCGAGGTAAATCTGAATGTTCTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-253s21c1
Sequence:CCGGTGATGGTGGTCGGTGAATCAGCTCGAGCTGATTCACCGACCACCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-455s21c1
Sequence:CCGGCGCTATCAACTGCAGAGATTGCTCGAGCAATCTCTGCAGTTGATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-1006s1c1
Sequence:CCGGCCCAGGACCTTCATTATGAAACTCGAGTTTCATAATGAAGGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-481s21c1
Sequence:CCGGAGACAATTATCTCCTATATTGCTCGAGCAATATAGGAGATAATTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004404.3-286s1c1
Sequence:CCGGCGACTCTCATAAACAGCCTATCTCGAGATAGGCTGTTTATGAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004404.3-1505s21c1
Sequence:CCGGAGAATCGGCATGTATACTTAACTCGAGTTAAGTATACATGCCGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004404.3-2957s1c1
Sequence:CCGGCGGAGTCCATTATTTGAGTTTCTCGAGAAACTCAAATAATGGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-617s1c1
Sequence:CCGGGCCCTTAGATGTGGCGTTTATCTCGAGATAAACGCCACATCTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-642s1c1
Sequence:CCGGGCAATACACAACAAGGTGAATCTCGAGATTCACCTTGTTGTGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004404
VALIDATED
SEPT2 MISSION shRNA shRNA Plasmid DNA
septin 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-848s21c1
Sequence:CCGGTGTGGTTGGATCCAATCAGTTCTCGAGAACTGATTGGATCCAACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-547s21c1
Sequence:CCGGGGCGGCACATCATTGATAATACTCGAGTATTATCAATGATGTGCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004404.3-1592s21c1
Sequence:CCGGATCTAGAACATTCAGATTTACCTCGAGGTAAATCTGAATGTTCTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-253s21c1
Sequence:CCGGTGATGGTGGTCGGTGAATCAGCTCGAGCTGATTCACCGACCACCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-455s21c1
Sequence:CCGGCGCTATCAACTGCAGAGATTGCTCGAGCAATCTCTGCAGTTGATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-1006s1c1
Sequence:CCGGCCCAGGACCTTCATTATGAAACTCGAGTTTCATAATGAAGGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-481s21c1
Sequence:CCGGAGACAATTATCTCCTATATTGCTCGAGCAATATAGGAGATAATTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004404.3-286s1c1
Sequence:CCGGCGACTCTCATAAACAGCCTATCTCGAGATAGGCTGTTTATGAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004404.3-1505s21c1
Sequence:CCGGAGAATCGGCATGTATACTTAACTCGAGTTAAGTATACATGCCGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004404.3-2957s1c1
Sequence:CCGGCGGAGTCCATTATTTGAGTTTCTCGAGAAACTCAAATAATGGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-617s1c1
Sequence:CCGGGCCCTTAGATGTGGCGTTTATCTCGAGATAAACGCCACATCTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-642s1c1
Sequence:CCGGGCAATACACAACAAGGTGAATCTCGAGATTCACCTTGTTGTGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004404
VALIDATED
SEPT2 MISSION shRNA Lentiviral Transduction Particles
septin 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-848s21c1
Sequence:CCGGTGTGGTTGGATCCAATCAGTTCTCGAGAACTGATTGGATCCAACCACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-547s21c1
Sequence:CCGGGGCGGCACATCATTGATAATACTCGAGTATTATCAATGATGTGCCGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004404.3-1592s21c1
Sequence:CCGGATCTAGAACATTCAGATTTACCTCGAGGTAAATCTGAATGTTCTAGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-253s21c1
Sequence:CCGGTGATGGTGGTCGGTGAATCAGCTCGAGCTGATTCACCGACCACCATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-455s21c1
Sequence:CCGGCGCTATCAACTGCAGAGATTGCTCGAGCAATCTCTGCAGTTGATAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-1006s1c1
Sequence:CCGGCCCAGGACCTTCATTATGAAACTCGAGTTTCATAATGAAGGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004404.3-481s21c1
Sequence:CCGGAGACAATTATCTCCTATATTGCTCGAGCAATATAGGAGATAATTGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004404.3-286s1c1
Sequence:CCGGCGACTCTCATAAACAGCCTATCTCGAGATAGGCTGTTTATGAGAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004404.3-1505s21c1
Sequence:CCGGAGAATCGGCATGTATACTTAACTCGAGTTAAGTATACATGCCGATTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004404.3-2957s1c1
Sequence:CCGGCGGAGTCCATTATTTGAGTTTCTCGAGAAACTCAAATAATGGACTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-617s1c1
Sequence:CCGGGCCCTTAGATGTGGCGTTTATCTCGAGATAAACGCCACATCTAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004404.3-642s1c1
Sequence:CCGGGCAATACACAACAAGGTGAATCTCGAGATTCACCTTGTTGTGTATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010891
VALIDATED
SEPT2 MISSION shRNA Bacterial Glycerol Stock
septin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-607s21c1
Sequence:CCGGCGATACACAATAAGGTGAATACTCGAGTATTCACCTTATTGTGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-345s21c1
Sequence:CCGGGCTTCGACTGTTGAGATTGAACTCGAGTTCAATCTCAACAGTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-1029s21c1
Sequence:CCGGGTAGAGAATGAGGACATGAATCTCGAGATTCATGTCCTCATTCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-578s21c1
Sequence:CCGGGAAGCCCTTAGATGTTGCATTCTCGAGAATGCAACATCTAAGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-562s1c1
Sequence:CCGGCGATACACAATAAGGTGAATACTCGAGTATTCACCTTATTGTGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010891.2-1821s21c1
Sequence:CCGGCGGCTTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-300s1c1
Sequence:CCGGGCTTCGACTGTTGAGATTGAACTCGAGTTCAATCTCAACAGTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-533s1c1
Sequence:CCGGGAAGCCCTTAGATGTTGCATTCTCGAGAATGCAACATCTAAGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010891.1-984s1c1
Sequence:CCGGGTAGAGAATGAGGACATGAATCTCGAGATTCATGTCCTCATTCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-1776s1c1
Sequence:CCGGCGGCTTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010891
VALIDATED
SEPT2 MISSION shRNA shRNA Plasmid DNA
septin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-607s21c1
Sequence:CCGGCGATACACAATAAGGTGAATACTCGAGTATTCACCTTATTGTGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-345s21c1
Sequence:CCGGGCTTCGACTGTTGAGATTGAACTCGAGTTCAATCTCAACAGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-1029s21c1
Sequence:CCGGGTAGAGAATGAGGACATGAATCTCGAGATTCATGTCCTCATTCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-578s21c1
Sequence:CCGGGAAGCCCTTAGATGTTGCATTCTCGAGAATGCAACATCTAAGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-562s1c1
Sequence:CCGGCGATACACAATAAGGTGAATACTCGAGTATTCACCTTATTGTGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010891.2-1821s21c1
Sequence:CCGGCGGCTTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-300s1c1
Sequence:CCGGGCTTCGACTGTTGAGATTGAACTCGAGTTCAATCTCAACAGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-533s1c1
Sequence:CCGGGAAGCCCTTAGATGTTGCATTCTCGAGAATGCAACATCTAAGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010891.1-984s1c1
Sequence:CCGGGTAGAGAATGAGGACATGAATCTCGAGATTCATGTCCTCATTCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-1776s1c1
Sequence:CCGGCGGCTTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010891
VALIDATED
SEPT2 MISSION shRNA Lentiviral Transduction Particles
septin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-607s21c1
Sequence:CCGGCGATACACAATAAGGTGAATACTCGAGTATTCACCTTATTGTGTATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-345s21c1
Sequence:CCGGGCTTCGACTGTTGAGATTGAACTCGAGTTCAATCTCAACAGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-1029s21c1
Sequence:CCGGGTAGAGAATGAGGACATGAATCTCGAGATTCATGTCCTCATTCTCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010891.2-578s21c1
Sequence:CCGGGAAGCCCTTAGATGTTGCATTCTCGAGAATGCAACATCTAAGGGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-562s1c1
Sequence:CCGGCGATACACAATAAGGTGAATACTCGAGTATTCACCTTATTGTGTATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010891.2-1821s21c1
Sequence:CCGGCGGCTTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-300s1c1
Sequence:CCGGGCTTCGACTGTTGAGATTGAACTCGAGTTCAATCTCAACAGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-533s1c1
Sequence:CCGGGAAGCCCTTAGATGTTGCATTCTCGAGAATGCAACATCTAAGGGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010891.1-984s1c1
Sequence:CCGGGTAGAGAATGAGGACATGAATCTCGAGATTCATGTCCTCATTCTCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010891.1-1776s1c1
Sequence:CCGGCGGCTTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)