EMAIL THIS PAGE TO A FRIEND

SEPT6

septin 6

187 Gene Product Result for
Synonyms: SEP2 SEPT2
Gene ID:
Human(23157) Summary: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(56526) septin 6
Rat(691335) septin 6
chicken(422369) septin 6
dog(612892) septin 6
cow(540783) septin 6
sheep(101102788) septin 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015129 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068181 MISSION® esiRNA esiRNA human SEPT6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015129 Rosetta Predictions human pricing
NM_145799 Rosetta Predictions human pricing
NM_145800 Rosetta Predictions human pricing
NM_145802 Rosetta Predictions human pricing
XM_001077761 Rosetta Predictions rat pricing
NM_019942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246224 predicted 899
2 SASI_Hs01_00246225 predicted 526
3 SASI_Hs01_00246226 predicted 697
4 SASI_Hs01_00246227 predicted 692
5 SASI_Hs01_00246228 predicted 1205
6 SASI_Hs01_00246229 predicted 542
7 SASI_Hs01_00246230 predicted 1213
8 SASI_Hs01_00246231 predicted 1319
9 SASI_Hs01_00246232 predicted 1082
10 SASI_Hs01_00246233 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176000 predicted 894
2 SASI_Hs01_00176001 predicted 531
3 SASI_Hs01_00176002 predicted 699
4 SASI_Hs01_00176003 predicted 687
5 SASI_Hs01_00176004 predicted 1205
6 SASI_Hs01_00176005 predicted 545
7 SASI_Hs01_00176006 predicted 1216
8 SASI_Hs01_00176007 predicted 1315
9 SASI_Hs01_00176008 predicted 1087
10 SASI_Hs01_00176009 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079874 predicted 891
2 SASI_Hs01_00079875 predicted 528
3 SASI_Hs01_00079876 predicted 701
4 SASI_Hs01_00079877 predicted 687
5 SASI_Hs01_00079878 predicted 1205
6 SASI_Hs01_00079879 predicted 539
7 SASI_Hs01_00079880 predicted 1210
8 SASI_Hs01_00079881 predicted 1319
9 SASI_Hs01_00079882 predicted 1088
10 SASI_Hs01_00079883 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150038 predicted 894
2 SASI_Hs01_00150039 predicted 526
3 SASI_Hs01_00150040 predicted 698
4 SASI_Hs01_00150041 predicted 691
5 SASI_Hs01_00150042 predicted 1201
6 SASI_Hs01_00150043 predicted 538
7 SASI_Hs01_00150044 predicted 1209
8 SASI_Hs01_00150045 predicted 1312
9 SASI_Hs01_00150046 predicted 1090
10 SASI_Hs01_00150047 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358442 predicted 713
2 SASI_Rn02_00358443 predicted 1227
3 SASI_Rn02_00358444 predicted 1576
4 SASI_Rn02_00358445 predicted 213
5 SASI_Rn02_00358446 predicted 242
6 SASI_Rn02_00358447 predicted 295
7 SASI_Rn02_00358448 predicted 1431
8 SASI_Rn02_00358449 predicted 252
9 SASI_Rn02_00358450 predicted 1581
10 SASI_Rn02_00358451 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083295 predicted 1338
2 SASI_Mm01_00083296 predicted 1000
3 SASI_Mm01_00083297 predicted 597
4 SASI_Mm01_00083299 predicted 223
5 SASI_Mm01_00083301 predicted 584
6 SASI_Mm01_00083302 predicted 751
7 SASI_Mm01_00083303 predicted 774
8 SASI_Mm01_00083304 predicted 515
9 SASI_Mm02_00325240 predicted 525
10 SASI_Mm02_00325241 predicted 657
11 SASI_Mm01_00083298 predicted 1406
12 SASI_Mm01_00083300 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019942
VALIDATED
SEPT6 MISSION shRNA Bacterial Glycerol Stock
septin 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-600s21c1
Sequence:CCGGCCAAGTCAGATGCCATTTCTACTCGAGTAGAAATGGCATCTGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019942.4-1757s21c1
Sequence:CCGGACTGTCTTCAGACACTATTAACTCGAGTTAATAGTGTCTGAAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-1228s21c1
Sequence:CCGGGAACGCCTTCAAGCAGAGAAACTCGAGTTTCTCTGCTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019942.2-1382s1c1
Sequence:CCGGGCCATTATAGAAGAGTTAGTTCTCGAGAACTAACTCTTCTATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-447s1c1
Sequence:CCGGGAGCTGAAGATCCGAAGAGTACTCGAGTACTCTTCGGATCTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-1229s1c1
Sequence:CCGGGAACGCCTTCAAGCAGAGAAACTCGAGTTTCTCTGCTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-517s21c1
Sequence:CCGGCCCGACAGGACATTCGCTTAACTCGAGTTAAGCGAATGTCCTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-601s1c1
Sequence:CCGGCCAAGTCAGATGCCATTTCTACTCGAGTAGAAATGGCATCTGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-234s1c1
Sequence:CCGGCTGTTTAACACCAAGTTTGAACTCGAGTTCAAACTTGGTGTTAAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019942
VALIDATED
SEPT6 MISSION shRNA shRNA Plasmid DNA
septin 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-600s21c1
Sequence:CCGGCCAAGTCAGATGCCATTTCTACTCGAGTAGAAATGGCATCTGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019942.4-1757s21c1
Sequence:CCGGACTGTCTTCAGACACTATTAACTCGAGTTAATAGTGTCTGAAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-1228s21c1
Sequence:CCGGGAACGCCTTCAAGCAGAGAAACTCGAGTTTCTCTGCTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019942.2-1382s1c1
Sequence:CCGGGCCATTATAGAAGAGTTAGTTCTCGAGAACTAACTCTTCTATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-447s1c1
Sequence:CCGGGAGCTGAAGATCCGAAGAGTACTCGAGTACTCTTCGGATCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-1229s1c1
Sequence:CCGGGAACGCCTTCAAGCAGAGAAACTCGAGTTTCTCTGCTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-517s21c1
Sequence:CCGGCCCGACAGGACATTCGCTTAACTCGAGTTAAGCGAATGTCCTGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-601s1c1
Sequence:CCGGCCAAGTCAGATGCCATTTCTACTCGAGTAGAAATGGCATCTGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-234s1c1
Sequence:CCGGCTGTTTAACACCAAGTTTGAACTCGAGTTCAAACTTGGTGTTAAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019942
VALIDATED
SEPT6 MISSION shRNA Lentiviral Transduction Particles
septin 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-600s21c1
Sequence:CCGGCCAAGTCAGATGCCATTTCTACTCGAGTAGAAATGGCATCTGACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019942.4-1757s21c1
Sequence:CCGGACTGTCTTCAGACACTATTAACTCGAGTTAATAGTGTCTGAAGACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-1228s21c1
Sequence:CCGGGAACGCCTTCAAGCAGAGAAACTCGAGTTTCTCTGCTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019942.2-1382s1c1
Sequence:CCGGGCCATTATAGAAGAGTTAGTTCTCGAGAACTAACTCTTCTATAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-447s1c1
Sequence:CCGGGAGCTGAAGATCCGAAGAGTACTCGAGTACTCTTCGGATCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-1229s1c1
Sequence:CCGGGAACGCCTTCAAGCAGAGAAACTCGAGTTTCTCTGCTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019942.4-517s21c1
Sequence:CCGGCCCGACAGGACATTCGCTTAACTCGAGTTAAGCGAATGTCCTGTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-601s1c1
Sequence:CCGGCCAAGTCAGATGCCATTTCTACTCGAGTAGAAATGGCATCTGACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019942.2-234s1c1
Sequence:CCGGCTGTTTAACACCAAGTTTGAACTCGAGTTCAAACTTGGTGTTAAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015129
VALIDATED
SEPT6 MISSION shRNA Bacterial Glycerol Stock
septin 6
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-1319s21c1
Sequence:CCGGGAGAAAGAAGCGGAGCTCAAACTCGAGTTTGAGCTCCGCTTCTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-828s1c1
Sequence:CCGGCCATTTCGAAGAGTGAGCTAACTCGAGTTAGCTCACTCTTCGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015129.4-2376s1c1
Sequence:CCGGGCCCTCATTTGCATTTGTGTACTCGAGTACACAAATGCAAATGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-704s1c1
Sequence:CCGGCGAATCCATGTCTGCTTGTATCTCGAGATACAAGCAGACATGGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-704s21c1
Sequence:CCGGCGAATCCATGTCTGCTTGTATCTCGAGATACAAGCAGACATGGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-889s21c1
Sequence:CCGGCGGAGTCCAGATCTATCAGTTCTCGAGAACTGATAGATCTGGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-606s21c1
Sequence:CCGGGCTACAAGCCTATCGTGGAATCTCGAGATTCCACGATAGGCTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-1093s21c1
Sequence:CCGGGATGCTGATTCGGGTCAACATCTCGAGATGTTGACCCGAATCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-559s1c1
Sequence:CCGGGATCGTTAGCACAGTTGGCTTCTCGAGAAGCCAACTGTGCTAACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-606s1c1
Sequence:CCGGGCTACAAGCCTATCGTGGAATCTCGAGATTCCACGATAGGCTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-703s1c1
Sequence:CCGGCCGAATCCATGTCTGCTTGTACTCGAGTACAAGCAGACATGGATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015129.4-889s1c1
Sequence:CCGGCGGAGTCCAGATCTATCAGTTCTCGAGAACTGATAGATCTGGACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-1319s1c1
Sequence:CCGGGAGAAAGAAGCGGAGCTCAAACTCGAGTTTGAGCTCCGCTTCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-1093s1c1
Sequence:CCGGGATGCTGATTCGGGTCAACATCTCGAGATGTTGACCCGAATCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015129
VALIDATED
SEPT6 MISSION shRNA shRNA Plasmid DNA
septin 6
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-1319s21c1
Sequence:CCGGGAGAAAGAAGCGGAGCTCAAACTCGAGTTTGAGCTCCGCTTCTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-828s1c1
Sequence:CCGGCCATTTCGAAGAGTGAGCTAACTCGAGTTAGCTCACTCTTCGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015129.4-2376s1c1
Sequence:CCGGGCCCTCATTTGCATTTGTGTACTCGAGTACACAAATGCAAATGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-704s1c1
Sequence:CCGGCGAATCCATGTCTGCTTGTATCTCGAGATACAAGCAGACATGGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-704s21c1
Sequence:CCGGCGAATCCATGTCTGCTTGTATCTCGAGATACAAGCAGACATGGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-889s21c1
Sequence:CCGGCGGAGTCCAGATCTATCAGTTCTCGAGAACTGATAGATCTGGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-606s21c1
Sequence:CCGGGCTACAAGCCTATCGTGGAATCTCGAGATTCCACGATAGGCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-1093s21c1
Sequence:CCGGGATGCTGATTCGGGTCAACATCTCGAGATGTTGACCCGAATCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-559s1c1
Sequence:CCGGGATCGTTAGCACAGTTGGCTTCTCGAGAAGCCAACTGTGCTAACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-606s1c1
Sequence:CCGGGCTACAAGCCTATCGTGGAATCTCGAGATTCCACGATAGGCTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-703s1c1
Sequence:CCGGCCGAATCCATGTCTGCTTGTACTCGAGTACAAGCAGACATGGATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015129.4-889s1c1
Sequence:CCGGCGGAGTCCAGATCTATCAGTTCTCGAGAACTGATAGATCTGGACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-1319s1c1
Sequence:CCGGGAGAAAGAAGCGGAGCTCAAACTCGAGTTTGAGCTCCGCTTCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-1093s1c1
Sequence:CCGGGATGCTGATTCGGGTCAACATCTCGAGATGTTGACCCGAATCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015129
VALIDATED
SEPT6 MISSION shRNA Lentiviral Transduction Particles
septin 6
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-1319s21c1
Sequence:CCGGGAGAAAGAAGCGGAGCTCAAACTCGAGTTTGAGCTCCGCTTCTTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-828s1c1
Sequence:CCGGCCATTTCGAAGAGTGAGCTAACTCGAGTTAGCTCACTCTTCGAAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015129.4-2376s1c1
Sequence:CCGGGCCCTCATTTGCATTTGTGTACTCGAGTACACAAATGCAAATGAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-704s1c1
Sequence:CCGGCGAATCCATGTCTGCTTGTATCTCGAGATACAAGCAGACATGGATTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-704s21c1
Sequence:CCGGCGAATCCATGTCTGCTTGTATCTCGAGATACAAGCAGACATGGATTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-889s21c1
Sequence:CCGGCGGAGTCCAGATCTATCAGTTCTCGAGAACTGATAGATCTGGACTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-606s21c1
Sequence:CCGGGCTACAAGCCTATCGTGGAATCTCGAGATTCCACGATAGGCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015129.5-1093s21c1
Sequence:CCGGGATGCTGATTCGGGTCAACATCTCGAGATGTTGACCCGAATCAGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-559s1c1
Sequence:CCGGGATCGTTAGCACAGTTGGCTTCTCGAGAAGCCAACTGTGCTAACGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-606s1c1
Sequence:CCGGGCTACAAGCCTATCGTGGAATCTCGAGATTCCACGATAGGCTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-703s1c1
Sequence:CCGGCCGAATCCATGTCTGCTTGTACTCGAGTACAAGCAGACATGGATTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015129.4-889s1c1
Sequence:CCGGCGGAGTCCAGATCTATCAGTTCTCGAGAACTGATAGATCTGGACTCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-1319s1c1
Sequence:CCGGGAGAAAGAAGCGGAGCTCAAACTCGAGTTTGAGCTCCGCTTCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015129.4-1093s1c1
Sequence:CCGGGATGCTGATTCGGGTCAACATCTCGAGATGTTGACCCGAATCAGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)