EMAIL THIS PAGE TO A FRIEND

SERAC1

serine active site containing 1

86 Gene Product Result for
UniProtKB ID: Q96JX3, Q49AT1, Q5VTX3, Q6PKF3
Gene ID:
Human(84947) Summary: The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Mouse(321007) serine active site containing 1
Rat(499015) serine active site containing 1
Zebrafish(568022) serine active site containing 1
domestic cat(101087745) serine active site containing 1
Horse(100051068) serine active site containing 1
dog(476255) serine active site containing 1
chicken(421657) serine active site containing 1
cow(519860) serine active site containing 1
sheep(101108234) serine active site containing 1
Domestic Rabbit(100338574) serine active site containing 1
naked mole-rat(101700820) serine active site containing 1
domestic guinea pig(100716991) serine active site containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032861 Rosetta Predictions human pricing
XM_001067207 Rosetta Predictions rat pricing
XM_574308 Rosetta Predictions rat pricing
NM_001033127 Rosetta Predictions mouse pricing
NM_001111017 Rosetta Predictions mouse pricing
NM_177311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055852 predicted 2092
2 SASI_Hs01_00055854 predicted 1270
3 SASI_Hs01_00055855 predicted 2134
4 SASI_Hs01_00055856 predicted 1301
5 SASI_Hs01_00055858 predicted 2010
6 SASI_Hs02_00360460 predicted 1866
7 SASI_Hs01_00055860 predicted 1656
8 SASI_Hs01_00055861 predicted 238
9 SASI_Hs02_00360461 predicted 1250
10 SASI_Hs02_00360462 predicted 423
11 SASI_Hs01_00055853 predicted 1730
12 SASI_Hs01_00055857 predicted 583
13 SASI_Hs01_00055859 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320231 predicted 1338
2 SASI_Rn02_00320232 predicted 686
3 SASI_Rn02_00320233 predicted 1069
4 SASI_Rn02_00320234 predicted 1562
5 SASI_Rn02_00320235 predicted 201
6 SASI_Rn02_00320236 predicted 1487
7 SASI_Rn02_00320237 predicted 1491
8 SASI_Rn02_00320238 predicted 905
9 SASI_Rn02_00320239 predicted 619
10 SASI_Rn02_00320240 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401722 predicted 1596
2 SASI_Rn02_00401723 predicted 943
3 SASI_Rn02_00401724 predicted 1326
4 SASI_Rn02_00401725 predicted 1827
5 SASI_Rn02_00401726 predicted 1745
6 SASI_Rn02_00401727 predicted 1749
7 SASI_Rn02_00401728 predicted 793
8 SASI_Rn02_00401729 predicted 1165
9 SASI_Rn02_00401730 predicted 875
10 SASI_Rn02_00401731 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116253 predicted 639
2 SASI_Mm01_00116254 predicted 831
3 SASI_Mm01_00116255 predicted 714
4 SASI_Mm01_00116256 predicted 818
5 SASI_Mm01_00116257 predicted 773
6 SASI_Mm01_00116258 predicted 708
7 SASI_Mm01_00116259 predicted 754
8 SASI_Mm01_00116260 predicted 861
9 SASI_Mm01_00116261 predicted 831
10 SASI_Mm01_00116262 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306058 predicted 1319
2 SASI_Mm02_00306059 predicted 1748
3 SASI_Mm02_00306060 predicted 1223
4 SASI_Mm02_00306061 predicted 1065
5 SASI_Mm02_00306062 predicted 1994
6 SASI_Mm02_00306063 predicted 1687
7 SASI_Mm02_00306064 predicted 1516
8 SASI_Mm02_00306065 predicted 1878
9 SASI_Mm02_00306066 predicted 1826
10 SASI_Mm02_00306067 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347387 predicted 1226
2 SASI_Mm02_00347388 predicted 1657
3 SASI_Mm02_00347389 predicted 1128
4 SASI_Mm02_00347390 predicted 981
5 SASI_Mm02_00347391 predicted 1897
6 SASI_Mm02_00347392 predicted 1591
7 SASI_Mm02_00347393 predicted 1429
8 SASI_Mm02_00347394 predicted 1788
9 SASI_Mm02_00347395 predicted 1742
10 SASI_Mm01_00127478 predicted 726
11 SASI_Mm01_00127472 predicted 612
12 SASI_Mm01_00127473 predicted 793
13 SASI_Mm01_00127474 predicted 686
14 SASI_Mm01_00127475 predicted 790
15 SASI_Mm01_00127476 predicted 743
16 SASI_Mm01_00127477 predicted 680
17 SASI_Mm01_00127479 predicted 824
18 SASI_Mm01_00127480 predicted 794
19 SASI_Mm01_00127481 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032861
VALIDATED
SERAC1 MISSION shRNA Bacterial Glycerol Stock
serine active site containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-246s21c1
Sequence:CCGGAGTTTACTGGATCACTTATTTCTCGAGAAATAAGTGATCCAGTAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-582s1c1
Sequence:CCGGGCATGATTACCAGTATAGGATCTCGAGATCCTATACTGGTAATCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1470s21c1
Sequence:CCGGGTCCTGCTCTCCGAATTATATCTCGAGATATAATTCGGAGAGCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1707s21c1
Sequence:CCGGACAATACCAGAGGAATAATTTCTCGAGAAATTATTCCTCTGGTATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1974s21c1
Sequence:CCGGTAGGCATTGGAGATCTAATTCCTCGAGGAATTAGATCTCCAATGCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032861.3-2549s21c1
Sequence:CCGGTTACTTCTGGGTATTGATTTGCTCGAGCAAATCAATACCCAGAAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032861.2-2723s1c1
Sequence:CCGGGCTTGGAATTTGTCCTAGATACTCGAGTATCTAGGACAAATTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032861.2-271s1c1
Sequence:CCGGGCTGTGACATTAGATACTCAACTCGAGTTGAGTATCTAATGTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1271s1c1
Sequence:CCGGCCATTAAAGCAGATGTCCTTTCTCGAGAAAGGACATCTGCTTTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1492s1c1
Sequence:CCGGCCTATGGAAAGAAAGTCCATTCTCGAGAATGGACTTTCTTTCCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032861.2-3782s1c1
Sequence:CCGGGCTGGTCAAATGGTAAGTCTACTCGAGTAGACTTACCATTTGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1778s1c1
Sequence:CCGGGCAAGGATTCTCCTGCACTTACTCGAGTAAGTGCAGGAGAATCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-646s1c1
Sequence:CCGGCGAAGCGAAGAGAGTGATCTTCTCGAGAAGATCACTCTCTTCGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032861
VALIDATED
SERAC1 MISSION shRNA shRNA Plasmid DNA
serine active site containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-246s21c1
Sequence:CCGGAGTTTACTGGATCACTTATTTCTCGAGAAATAAGTGATCCAGTAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-582s1c1
Sequence:CCGGGCATGATTACCAGTATAGGATCTCGAGATCCTATACTGGTAATCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1470s21c1
Sequence:CCGGGTCCTGCTCTCCGAATTATATCTCGAGATATAATTCGGAGAGCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1707s21c1
Sequence:CCGGACAATACCAGAGGAATAATTTCTCGAGAAATTATTCCTCTGGTATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1974s21c1
Sequence:CCGGTAGGCATTGGAGATCTAATTCCTCGAGGAATTAGATCTCCAATGCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032861.3-2549s21c1
Sequence:CCGGTTACTTCTGGGTATTGATTTGCTCGAGCAAATCAATACCCAGAAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032861.2-2723s1c1
Sequence:CCGGGCTTGGAATTTGTCCTAGATACTCGAGTATCTAGGACAAATTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032861.2-271s1c1
Sequence:CCGGGCTGTGACATTAGATACTCAACTCGAGTTGAGTATCTAATGTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1271s1c1
Sequence:CCGGCCATTAAAGCAGATGTCCTTTCTCGAGAAAGGACATCTGCTTTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1492s1c1
Sequence:CCGGCCTATGGAAAGAAAGTCCATTCTCGAGAATGGACTTTCTTTCCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032861.2-3782s1c1
Sequence:CCGGGCTGGTCAAATGGTAAGTCTACTCGAGTAGACTTACCATTTGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1778s1c1
Sequence:CCGGGCAAGGATTCTCCTGCACTTACTCGAGTAAGTGCAGGAGAATCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-646s1c1
Sequence:CCGGCGAAGCGAAGAGAGTGATCTTCTCGAGAAGATCACTCTCTTCGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032861
VALIDATED
SERAC1 MISSION shRNA Lentiviral Transduction Particles
serine active site containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-246s21c1
Sequence:CCGGAGTTTACTGGATCACTTATTTCTCGAGAAATAAGTGATCCAGTAAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-582s1c1
Sequence:CCGGGCATGATTACCAGTATAGGATCTCGAGATCCTATACTGGTAATCATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1470s21c1
Sequence:CCGGGTCCTGCTCTCCGAATTATATCTCGAGATATAATTCGGAGAGCAGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1707s21c1
Sequence:CCGGACAATACCAGAGGAATAATTTCTCGAGAAATTATTCCTCTGGTATTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032861.3-1974s21c1
Sequence:CCGGTAGGCATTGGAGATCTAATTCCTCGAGGAATTAGATCTCCAATGCCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032861.3-2549s21c1
Sequence:CCGGTTACTTCTGGGTATTGATTTGCTCGAGCAAATCAATACCCAGAAGTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032861.2-2723s1c1
Sequence:CCGGGCTTGGAATTTGTCCTAGATACTCGAGTATCTAGGACAAATTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032861.2-271s1c1
Sequence:CCGGGCTGTGACATTAGATACTCAACTCGAGTTGAGTATCTAATGTCACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1271s1c1
Sequence:CCGGCCATTAAAGCAGATGTCCTTTCTCGAGAAAGGACATCTGCTTTAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1492s1c1
Sequence:CCGGCCTATGGAAAGAAAGTCCATTCTCGAGAATGGACTTTCTTTCCATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032861.2-3782s1c1
Sequence:CCGGGCTGGTCAAATGGTAAGTCTACTCGAGTAGACTTACCATTTGACCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-1778s1c1
Sequence:CCGGGCAAGGATTCTCCTGCACTTACTCGAGTAAGTGCAGGAGAATCCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032861.2-646s1c1
Sequence:CCGGCGAAGCGAAGAGAGTGATCTTCTCGAGAAGATCACTCTCTTCGCTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177311
SERAC1 MISSION shRNA Bacterial Glycerol Stock
serine active site containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-505s1c1
Sequence:CCGGCATGACTACCAGTACAGGATACTCGAGTATCCTGTACTGGTAGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-1684s1c1
Sequence:CCGGGAAGTCAAAGAACTCAGCAAACTCGAGTTTGCTGAGTTCTTTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-568s1c1
Sequence:CCGGCGAAGCAAAGAAAGTGATCTTCTCGAGAAGATCACTTTCTTTGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-565s1c1
Sequence:CCGGGCACGAAGCAAAGAAAGTGATCTCGAGATCACTTTCTTTGCTTCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-1563s1c1
Sequence:CCGGGCCCGAACTGAATGCTCTTATCTCGAGATAAGAGCATTCAGTTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.4-1649s1c1
Sequence:CCGGGGCTGAATACTCCGTTAATATCTCGAGATATTAACGGAGTATTCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177311
SERAC1 MISSION shRNA shRNA Plasmid DNA
serine active site containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-505s1c1
Sequence:CCGGCATGACTACCAGTACAGGATACTCGAGTATCCTGTACTGGTAGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-1684s1c1
Sequence:CCGGGAAGTCAAAGAACTCAGCAAACTCGAGTTTGCTGAGTTCTTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-568s1c1
Sequence:CCGGCGAAGCAAAGAAAGTGATCTTCTCGAGAAGATCACTTTCTTTGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-565s1c1
Sequence:CCGGGCACGAAGCAAAGAAAGTGATCTCGAGATCACTTTCTTTGCTTCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-1563s1c1
Sequence:CCGGGCCCGAACTGAATGCTCTTATCTCGAGATAAGAGCATTCAGTTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.4-1649s1c1
Sequence:CCGGGGCTGAATACTCCGTTAATATCTCGAGATATTAACGGAGTATTCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177311
SERAC1 MISSION shRNA Lentiviral Transduction Particles
serine active site containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-505s1c1
Sequence:CCGGCATGACTACCAGTACAGGATACTCGAGTATCCTGTACTGGTAGTCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-1684s1c1
Sequence:CCGGGAAGTCAAAGAACTCAGCAAACTCGAGTTTGCTGAGTTCTTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-568s1c1
Sequence:CCGGCGAAGCAAAGAAAGTGATCTTCTCGAGAAGATCACTTTCTTTGCTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-565s1c1
Sequence:CCGGGCACGAAGCAAAGAAAGTGATCTCGAGATCACTTTCTTTGCTTCGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.2-1563s1c1
Sequence:CCGGGCCCGAACTGAATGCTCTTATCTCGAGATAAGAGCATTCAGTTCGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177311.4-1649s1c1
Sequence:CCGGGGCTGAATACTCCGTTAATATCTCGAGATATTAACGGAGTATTCAGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)