EMAIL THIS PAGE TO A FRIEND

SERBP1

SERPINE1 mRNA binding protein 1

222 Gene Product Result for
Synonyms: CHD3IP HABP4L PAI-RBP1 PAIRBP1
Gene ID:
Mouse(66870) serpine1 mRNA binding protein 1
Rat(246303) Serpine1 mRNA binding protein 1
chicken(424706) SERPINE1 mRNA binding protein 1
domestic cat(100169729) SERPINE1 mRNA binding protein 1
domestic cat(101088600) SERPINE1 mRNA binding protein 1
dog(479535) SERPINE1 mRNA binding protein 1
domestic guinea pig(100722494) SERPINE1 mRNA binding protein 1
naked mole-rat(101696577) SERPINE1 mRNA binding protein 1
cow(539060) SERPINE1 mRNA binding protein 1
sheep(101114476) SERPINE1 mRNA binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090531 MISSION® esiRNA esiRNA human SERBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018067 Rosetta Predictions human pricing
NM_001018068 Rosetta Predictions human pricing
NM_001018069 Rosetta Predictions human pricing
NM_015640 Rosetta Predictions human pricing
NM_145086 Rosetta Predictions rat pricing
NM_001113564 Rosetta Predictions mouse pricing
NM_001113565 Rosetta Predictions mouse pricing
NM_001113566 Rosetta Predictions mouse pricing
NM_025814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191994 predicted 1831
2 SASI_Hs01_00191995 predicted 1821
3 SASI_Hs01_00191996 predicted 1860
4 SASI_Hs01_00191997 predicted 1816
5 SASI_Hs01_00191998 predicted 1691
6 SASI_Hs01_00191999 predicted 1679
7 SASI_Hs01_00192000 predicted 333
8 SASI_Hs01_00192002 predicted 1807
9 SASI_Hs01_00192003 predicted 1828
10 SASI_Hs02_00306956 predicted 323
11 SASI_Hs01_00192001 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144267 predicted 1806
2 SASI_Hs01_00144268 predicted 1802
3 SASI_Hs01_00144269 predicted 1843
4 SASI_Hs01_00144270 predicted 1794
5 SASI_Hs02_00306957 predicted 1106
6 SASI_Hs01_00144271 predicted 1666
7 SASI_Hs01_00144272 predicted 1665
8 SASI_Hs02_00306958 predicted 1681
9 SASI_Hs01_00144273 predicted 335
10 SASI_Hs01_00144275 predicted 1789
11 SASI_Hs01_00144274 predicted 1677
12 SASI_Hs01_00144276 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101186 predicted 1782
2 SASI_Hs01_00101187 predicted 1770
3 SASI_Hs01_00101188 predicted 1814
4 SASI_Hs01_00101189 predicted 1763
5 SASI_Hs02_00306959 predicted 1074
6 SASI_Hs01_00101190 predicted 1646
7 SASI_Hs01_00101191 predicted 1638
8 SASI_Hs02_00306960 predicted 1657
9 SASI_Hs01_00101192 predicted 335
10 SASI_Hs01_00101194 predicted 1759
11 SASI_Hs01_00101193 predicted 1656
12 SASI_Hs01_00101195 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055312 predicted 1763
2 SASI_Hs01_00055313 predicted 1754
3 SASI_Hs01_00055314 predicted 1804
4 SASI_Hs01_00055315 predicted 1748
5 SASI_Hs02_00348245 predicted 1063
6 SASI_Hs01_00055316 predicted 1620
7 SASI_Hs01_00055317 predicted 1619
8 SASI_Hs02_00348246 predicted 1635
9 SASI_Hs01_00055318 predicted 332
10 SASI_Hs01_00055320 predicted 1743
11 SASI_Hs01_00055319 predicted 1631
12 SASI_Hs01_00055321 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100672 predicted 758
2 SASI_Rn01_00100673 predicted 456
3 SASI_Rn01_00100674 predicted 258
4 SASI_Rn01_00100675 predicted 882
5 SASI_Rn01_00100678 predicted 1065
6 SASI_Rn02_00268670 predicted 972
7 SASI_Rn02_00268671 predicted 654
8 SASI_Rn01_00100679 predicted 529
9 SASI_Rn01_00100680 predicted 835
10 SASI_Rn01_00100681 predicted 1005
11 SASI_Rn01_00100676 predicted 980
12 SASI_Rn01_00100677 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308229 predicted 466
2 SASI_Mm02_00308230 predicted 467
3 SASI_Mm02_00308231 predicted 1788
4 SASI_Mm02_00308232 predicted 454
5 SASI_Mm02_00308233 predicted 308
6 SASI_Mm02_00308234 predicted 1780
7 SASI_Mm02_00308235 predicted 1710
8 SASI_Mm02_00308236 predicted 1667
9 SASI_Mm02_00308237 predicted 1661
10 SASI_Mm02_00308238 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308239 predicted 464
2 SASI_Mm02_00308240 predicted 464
3 SASI_Mm02_00308241 predicted 1762
4 SASI_Mm02_00308242 predicted 452
5 SASI_Mm02_00308243 predicted 306
6 SASI_Mm02_00308244 predicted 1755
7 SASI_Mm02_00308245 predicted 1678
8 SASI_Mm02_00308246 predicted 1639
9 SASI_Mm02_00308247 predicted 1629
10 SASI_Mm02_00308248 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308249 predicted 463
2 SASI_Mm02_00308250 predicted 473
3 SASI_Mm02_00308251 predicted 1750
4 SASI_Mm02_00308252 predicted 449
5 SASI_Mm02_00308253 predicted 306
6 SASI_Mm02_00308254 predicted 1740
7 SASI_Mm02_00308255 predicted 1659
8 SASI_Mm02_00308256 predicted 1619
9 SASI_Mm02_00308257 predicted 1619
10 SASI_Mm02_00308258 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329055 predicted 470
2 SASI_Mm02_00329056 predicted 471
3 SASI_Mm02_00329057 predicted 1810
4 SASI_Mm01_00180040 predicted 451
5 SASI_Mm02_00329058 predicted 306
6 SASI_Mm02_00329059 predicted 1805
7 SASI_Mm02_00329060 predicted 1720
8 SASI_Mm02_00329061 predicted 1688
9 SASI_Mm02_00329062 predicted 1678
10 SASI_Mm02_00329063 predicted 1732
11 SASI_Mm01_00180037 predicted 482
12 SASI_Mm01_00180038 predicted 847
13 SASI_Mm01_00180039 predicted 588
14 SASI_Mm01_00180041 predicted 860
15 SASI_Mm01_00180042 predicted 942
16 SASI_Mm01_00180043 predicted 669
17 SASI_Mm01_00180044 predicted 513
18 SASI_Mm01_00180045 predicted 460
19 SASI_Mm01_00180046 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015640
VALIDATED
SERBP1 MISSION shRNA Bacterial Glycerol Stock
SERPINE1 mRNA binding protein 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-679s21c1
Sequence:CCGGGCCGAGGAGATGGATTTGATTCTCGAGAATCAAATCCATCTCCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015640.3-852s21c1
Sequence:CCGGCCTGAAGGTGAAGAACATCATCTCGAGATGATGTTCTTCACCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-624s1c1
Sequence:CCGGGCCGAGGAGATGGATTTGATTCTCGAGAATCAAATCCATCTCCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-797s1c1
Sequence:CCGGCCTGAAGGTGAAGAACATCATCTCGAGATGATGTTCTTCACCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-383s1c1
Sequence:CCGGGCGCTTAAGAAAGAAGGAATACTCGAGTATTCCTTCTTTCTTAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-982s1c1
Sequence:CCGGGAAGGGATTTGTTCTTCATAACTCGAGTTATGAAGAACAAATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-974s1c1
Sequence:CCGGCAGTGGAAGAAGGGATTTGTTCTCGAGAACAAATCCCTTCTTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-425s1c1
Sequence:CCGGGATCAACAACTTCAGGGTGAACTCGAGTTCACCCTGAAGTTGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-1031s1c1
Sequence:CCGGGATTCGGTTATGGACCATCATCTCGAGATGATGGTCCATAACCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-1019s1c1
Sequence:CCGGGCTCATGCTGAAGATTCGGTTCTCGAGAACCGAATCTTCAGCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-796s21c1
Sequence:CCGGGAACTGTCAAAGACGAATTAACTCGAGTTAATTCGTCTTTGACAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-438s21c1
Sequence:CCGGGCGCTTAAGAAAGAAGGAATACTCGAGTATTCCTTCTTTCTTAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-1086s21c1
Sequence:CCGGGATTCGGTTATGGACCATCATCTCGAGATGATGGTCCATAACCGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-741s1c1
Sequence:CCGGGAACTGTCAAAGACGAATTAACTCGAGTTAATTCGTCTTTGACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-126s1c1
Sequence:CCGGCCAACCGATTCGACCAGTTATCTCGAGATAACTGGTCGAATCGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-341s1c1
Sequence:CCGGGTTGGCGTGGTTGACAAGAAACTCGAGTTTCTTGTCAACCACGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-551s1c1
Sequence:CCGGCCGATTATTGACCGACCTATTCTCGAGAATAGGTCGGTCAATAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-647s1c1
Sequence:CCGGCGTGGCAAACGTGAATTTGATCTCGAGATCAAATTCACGTTTGCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015640
VALIDATED
SERBP1 MISSION shRNA shRNA Plasmid DNA
SERPINE1 mRNA binding protein 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-679s21c1
Sequence:CCGGGCCGAGGAGATGGATTTGATTCTCGAGAATCAAATCCATCTCCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015640.3-852s21c1
Sequence:CCGGCCTGAAGGTGAAGAACATCATCTCGAGATGATGTTCTTCACCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-624s1c1
Sequence:CCGGGCCGAGGAGATGGATTTGATTCTCGAGAATCAAATCCATCTCCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-797s1c1
Sequence:CCGGCCTGAAGGTGAAGAACATCATCTCGAGATGATGTTCTTCACCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-383s1c1
Sequence:CCGGGCGCTTAAGAAAGAAGGAATACTCGAGTATTCCTTCTTTCTTAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-982s1c1
Sequence:CCGGGAAGGGATTTGTTCTTCATAACTCGAGTTATGAAGAACAAATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-974s1c1
Sequence:CCGGCAGTGGAAGAAGGGATTTGTTCTCGAGAACAAATCCCTTCTTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-425s1c1
Sequence:CCGGGATCAACAACTTCAGGGTGAACTCGAGTTCACCCTGAAGTTGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-1031s1c1
Sequence:CCGGGATTCGGTTATGGACCATCATCTCGAGATGATGGTCCATAACCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-1019s1c1
Sequence:CCGGGCTCATGCTGAAGATTCGGTTCTCGAGAACCGAATCTTCAGCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-796s21c1
Sequence:CCGGGAACTGTCAAAGACGAATTAACTCGAGTTAATTCGTCTTTGACAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-438s21c1
Sequence:CCGGGCGCTTAAGAAAGAAGGAATACTCGAGTATTCCTTCTTTCTTAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-1086s21c1
Sequence:CCGGGATTCGGTTATGGACCATCATCTCGAGATGATGGTCCATAACCGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-741s1c1
Sequence:CCGGGAACTGTCAAAGACGAATTAACTCGAGTTAATTCGTCTTTGACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-126s1c1
Sequence:CCGGCCAACCGATTCGACCAGTTATCTCGAGATAACTGGTCGAATCGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-341s1c1
Sequence:CCGGGTTGGCGTGGTTGACAAGAAACTCGAGTTTCTTGTCAACCACGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-551s1c1
Sequence:CCGGCCGATTATTGACCGACCTATTCTCGAGAATAGGTCGGTCAATAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-647s1c1
Sequence:CCGGCGTGGCAAACGTGAATTTGATCTCGAGATCAAATTCACGTTTGCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015640
VALIDATED
SERBP1 MISSION shRNA Lentiviral Transduction Particles
SERPINE1 mRNA binding protein 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-679s21c1
Sequence:CCGGGCCGAGGAGATGGATTTGATTCTCGAGAATCAAATCCATCTCCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015640.3-852s21c1
Sequence:CCGGCCTGAAGGTGAAGAACATCATCTCGAGATGATGTTCTTCACCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-624s1c1
Sequence:CCGGGCCGAGGAGATGGATTTGATTCTCGAGAATCAAATCCATCTCCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-797s1c1
Sequence:CCGGCCTGAAGGTGAAGAACATCATCTCGAGATGATGTTCTTCACCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-383s1c1
Sequence:CCGGGCGCTTAAGAAAGAAGGAATACTCGAGTATTCCTTCTTTCTTAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-982s1c1
Sequence:CCGGGAAGGGATTTGTTCTTCATAACTCGAGTTATGAAGAACAAATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-974s1c1
Sequence:CCGGCAGTGGAAGAAGGGATTTGTTCTCGAGAACAAATCCCTTCTTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-425s1c1
Sequence:CCGGGATCAACAACTTCAGGGTGAACTCGAGTTCACCCTGAAGTTGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-1031s1c1
Sequence:CCGGGATTCGGTTATGGACCATCATCTCGAGATGATGGTCCATAACCGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-1019s1c1
Sequence:CCGGGCTCATGCTGAAGATTCGGTTCTCGAGAACCGAATCTTCAGCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-796s21c1
Sequence:CCGGGAACTGTCAAAGACGAATTAACTCGAGTTAATTCGTCTTTGACAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-438s21c1
Sequence:CCGGGCGCTTAAGAAAGAAGGAATACTCGAGTATTCCTTCTTTCTTAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015640.3-1086s21c1
Sequence:CCGGGATTCGGTTATGGACCATCATCTCGAGATGATGGTCCATAACCGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-741s1c1
Sequence:CCGGGAACTGTCAAAGACGAATTAACTCGAGTTAATTCGTCTTTGACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-126s1c1
Sequence:CCGGCCAACCGATTCGACCAGTTATCTCGAGATAACTGGTCGAATCGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015640.1-341s1c1
Sequence:CCGGGTTGGCGTGGTTGACAAGAAACTCGAGTTTCTTGTCAACCACGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-551s1c1
Sequence:CCGGCCGATTATTGACCGACCTATTCTCGAGAATAGGTCGGTCAATAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015640.1-647s1c1
Sequence:CCGGCGTGGCAAACGTGAATTTGATCTCGAGATCAAATTCACGTTTGCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025814
SERBP1 MISSION shRNA Bacterial Glycerol Stock
SERPINE1 mRNA binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-1269s1c1
Sequence:CCGGGCAGCAGGACTGATAAGTCAACTCGAGTTGACTTATCAGTCCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025814.1-2993s1c1
Sequence:CCGGCCCTTTGAGATTGTAGCATATCTCGAGATATGCTACAATCTCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-516s1c1
Sequence:CCGGCCCGTGAAAGAAGATTTGAAACTCGAGTTTCAAATCTTCTTTCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-417s1c1
Sequence:CCGGCGCTTAAGAAAGAAGGAATAACTCGAGTTATTCCTTCTTTCTTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-855s1c1
Sequence:CCGGGCAGTGATTTGGATCAATCAACTCGAGTTGATTGATCCAAATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025814
SERBP1 MISSION shRNA shRNA Plasmid DNA
SERPINE1 mRNA binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-1269s1c1
Sequence:CCGGGCAGCAGGACTGATAAGTCAACTCGAGTTGACTTATCAGTCCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025814.1-2993s1c1
Sequence:CCGGCCCTTTGAGATTGTAGCATATCTCGAGATATGCTACAATCTCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-516s1c1
Sequence:CCGGCCCGTGAAAGAAGATTTGAAACTCGAGTTTCAAATCTTCTTTCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-417s1c1
Sequence:CCGGCGCTTAAGAAAGAAGGAATAACTCGAGTTATTCCTTCTTTCTTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-855s1c1
Sequence:CCGGGCAGTGATTTGGATCAATCAACTCGAGTTGATTGATCCAAATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025814
SERBP1 MISSION shRNA Lentiviral Transduction Particles
SERPINE1 mRNA binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-1269s1c1
Sequence:CCGGGCAGCAGGACTGATAAGTCAACTCGAGTTGACTTATCAGTCCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025814.1-2993s1c1
Sequence:CCGGCCCTTTGAGATTGTAGCATATCTCGAGATATGCTACAATCTCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-516s1c1
Sequence:CCGGCCCGTGAAAGAAGATTTGAAACTCGAGTTTCAAATCTTCTTTCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-417s1c1
Sequence:CCGGCGCTTAAGAAAGAAGGAATAACTCGAGTTATTCCTTCTTTCTTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025814.1-855s1c1
Sequence:CCGGGCAGTGATTTGGATCAATCAACTCGAGTTGATTGATCCAAATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)