EMAIL THIS PAGE TO A FRIEND

SERHL2

serine hydrolase-like 2

25 Gene Product Result for
Synonyms: dJ222E13.1
Gene ID:
Rat(500911) serine hydrolase-like 2
chicken(417976) serine hydrolase-like 2
dog(474481) serine hydrolase-like 2
cow(531992) serine hydrolase-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014509 Rosetta Predictions human pricing
NM_001130579 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116995 predicted 951
2 SASI_Hs01_00116997 predicted 643
3 SASI_Hs01_00116998 predicted 335
4 SASI_Hs01_00116999 predicted 983
5 SASI_Hs01_00117000 predicted 899
6 SASI_Hs01_00117001 predicted 338
7 SASI_Hs01_00117002 predicted 858
8 SASI_Hs01_00117003 predicted 542
9 SASI_Hs01_00117004 predicted 1085
10 SASI_Hs02_00345777 predicted 513
11 SASI_Hs01_00116996 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255959 predicted 1517
2 SASI_Rn02_00255960 predicted 747
3 SASI_Rn02_00255961 predicted 953
4 SASI_Rn02_00255962 predicted 903
5 SASI_Rn02_00255963 predicted 1316
6 SASI_Rn02_00255964 predicted 1398
7 SASI_Rn02_00255965 predicted 778
8 SASI_Rn02_00255966 predicted 936
9 SASI_Rn02_00255967 predicted 920
10 SASI_Rn02_00255968 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014509
SERHL2 MISSION shRNA Bacterial Glycerol Stock
serine hydrolase-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014509.3-1054s1c1
Sequence:CCGGGCCTGGAACTATGAAGACCTACTCGAGTAGGTCTTCATAGTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-904s1c1
Sequence:CCGGACGATGAAATCCACCCTCAAACTCGAGTTTGAGGGTGGATTTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-684s1c1
Sequence:CCGGCCTGCAAAGAGGAACCACGAACTCGAGTTCGTGGTTCCTCTTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-630s1c1
Sequence:CCGGGCAGAGGTTACTGAAGAGCAACTCGAGTTGCTCTTCAGTAACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-639s1c1
Sequence:CCGGACTGAAGAGCAATAGCCACTTCTCGAGAAGTGGCTATTGCTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014509
SERHL2 MISSION shRNA shRNA Plasmid DNA
serine hydrolase-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014509.3-1054s1c1
Sequence:CCGGGCCTGGAACTATGAAGACCTACTCGAGTAGGTCTTCATAGTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-904s1c1
Sequence:CCGGACGATGAAATCCACCCTCAAACTCGAGTTTGAGGGTGGATTTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-684s1c1
Sequence:CCGGCCTGCAAAGAGGAACCACGAACTCGAGTTCGTGGTTCCTCTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-630s1c1
Sequence:CCGGGCAGAGGTTACTGAAGAGCAACTCGAGTTGCTCTTCAGTAACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-639s1c1
Sequence:CCGGACTGAAGAGCAATAGCCACTTCTCGAGAAGTGGCTATTGCTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014509
SERHL2 MISSION shRNA Lentiviral Transduction Particles
serine hydrolase-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014509.3-1054s1c1
Sequence:CCGGGCCTGGAACTATGAAGACCTACTCGAGTAGGTCTTCATAGTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-904s1c1
Sequence:CCGGACGATGAAATCCACCCTCAAACTCGAGTTTGAGGGTGGATTTCATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-684s1c1
Sequence:CCGGCCTGCAAAGAGGAACCACGAACTCGAGTTCGTGGTTCCTCTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-630s1c1
Sequence:CCGGGCAGAGGTTACTGAAGAGCAACTCGAGTTGCTCTTCAGTAACCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014509.3-639s1c1
Sequence:CCGGACTGAAGAGCAATAGCCACTTCTCGAGAAGTGGCTATTGCTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)