EMAIL THIS PAGE TO A FRIEND

SERPINA1

serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1

160 Gene Product Result for
Synonyms: A1A A1AT AAT PI PI1 PRO2275 alpha1AT
Gene ID:
Human(5265) Summary: The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(24648) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
Zebrafish(322701) serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
domestic cat(101080897) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
dog(480422) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
chicken(423434) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
cow(280699) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
sheep(443388) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000295 Rosetta Predictions human pricing
NM_001002235 Rosetta Predictions human pricing
NM_001002236 Rosetta Predictions human pricing
NM_001127700 Rosetta Predictions human pricing
NM_001127701 Rosetta Predictions human pricing
NM_001127702 Rosetta Predictions human pricing
NM_001127703 Rosetta Predictions human pricing
NM_001127704 Rosetta Predictions human pricing
NM_001127705 Rosetta Predictions human pricing
NM_001127706 Rosetta Predictions human pricing
NM_001127707 Rosetta Predictions human pricing
NM_022519 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021401 predicted 1201
2 SASI_Hs02_00302269 predicted 784
3 SASI_Hs02_00302270 predicted 1177
4 SASI_Hs02_00302271 predicted 1239
5 SASI_Hs02_00302272 predicted 1607
6 SASI_Hs02_00302273 predicted 1001
7 SASI_Hs01_00021409 predicted 1100
8 SASI_Hs02_00302274 predicted 1047
9 SASI_Hs02_00302275 predicted 1203
10 SASI_Hs02_00302276 predicted 902
11 SASI_Hs01_00021400 predicted 986
12 SASI_Hs01_00021402 predicted 1184
13 SASI_Hs01_00021403 predicted 1241
14 SASI_Hs01_00021404 predicted 1335
15 SASI_Hs01_00021405 predicted 588
16 SASI_Hs01_00021406 predicted 860
17 SASI_Hs01_00021407 predicted 912
18 SASI_Hs01_00021408 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113138 predicted 1175
2 SASI_Hs02_00304116 predicted 769
3 SASI_Hs02_00304117 predicted 1158
4 SASI_Hs02_00304118 predicted 1216
5 SASI_Hs02_00304119 predicted 1587
6 SASI_Hs02_00304120 predicted 977
7 SASI_Hs01_00113146 predicted 1078
8 SASI_Hs02_00304121 predicted 1032
9 SASI_Hs02_00304122 predicted 1186
10 SASI_Hs02_00304123 predicted 881
11 SASI_Hs01_00113137 predicted 959
12 SASI_Hs01_00113139 predicted 1168
13 SASI_Hs01_00113140 predicted 1222
14 SASI_Hs01_00113141 predicted 1323
15 SASI_Hs01_00113142 predicted 562
16 SASI_Hs01_00113143 predicted 842
17 SASI_Hs01_00113144 predicted 898
18 SASI_Hs01_00113145 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239334 predicted 1492
2 SASI_Hs02_00304124 predicted 1075
3 SASI_Hs02_00304125 predicted 1476
4 SASI_Hs02_00304126 predicted 1527
5 SASI_Hs02_00304127 predicted 1905
6 SASI_Hs02_00304128 predicted 1297
7 SASI_Hs01_00239342 predicted 1399
8 SASI_Hs02_00304129 predicted 1338
9 SASI_Hs02_00304130 predicted 1498
10 SASI_Hs02_00304131 predicted 1200
11 SASI_Hs01_00239333 predicted 1281
12 SASI_Hs01_00239335 predicted 1473
13 SASI_Hs01_00239336 predicted 1530
14 SASI_Hs01_00239337 predicted 1631
15 SASI_Hs01_00239338 predicted 877
16 SASI_Hs01_00239339 predicted 1156
17 SASI_Hs01_00239340 predicted 1205
18 SASI_Hs01_00239341 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330204 predicted 1214
2 SASI_Hs02_00330205 predicted 804
3 SASI_Hs02_00330206 predicted 1193
4 SASI_Hs02_00330207 predicted 1254
5 SASI_Hs02_00330208 predicted 1626
6 SASI_Hs02_00330209 predicted 1022
7 SASI_Hs02_00330210 predicted 1117
8 SASI_Hs02_00330211 predicted 1065
9 SASI_Hs02_00330212 predicted 1220
10 SASI_Hs02_00330213 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330214 predicted 1511
2 SASI_Hs02_00330215 predicted 1096
3 SASI_Hs02_00330216 predicted 1489
4 SASI_Hs02_00330217 predicted 1548
5 SASI_Hs02_00330218 predicted 1924
6 SASI_Hs02_00330219 predicted 1314
7 SASI_Hs02_00330220 predicted 1410
8 SASI_Hs02_00330221 predicted 1361
9 SASI_Hs02_00330222 predicted 1510
10 SASI_Hs02_00330223 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330224 predicted 1320
2 SASI_Hs02_00330225 predicted 907
3 SASI_Hs02_00330226 predicted 1296
4 SASI_Hs02_00330227 predicted 1362
5 SASI_Hs02_00330228 predicted 1729
6 SASI_Hs02_00330229 predicted 1120
7 SASI_Hs02_00330230 predicted 1218
8 SASI_Hs02_00330231 predicted 1169
9 SASI_Hs02_00330232 predicted 1326
10 SASI_Hs02_00330233 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330234 predicted 1475
2 SASI_Hs02_00330235 predicted 1063
3 SASI_Hs02_00330236 predicted 1453
4 SASI_Hs02_00330237 predicted 1511
5 SASI_Hs02_00330238 predicted 1888
6 SASI_Hs02_00330239 predicted 1276
7 SASI_Hs02_00330240 predicted 1378
8 SASI_Hs02_00330241 predicted 1319
9 SASI_Hs02_00330242 predicted 1473
10 SASI_Hs02_00330243 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330244 predicted 1469
2 SASI_Hs02_00330245 predicted 1057
3 SASI_Hs02_00330246 predicted 1455
4 SASI_Hs02_00330247 predicted 1513
5 SASI_Hs02_00330248 predicted 1883
6 SASI_Hs02_00330249 predicted 1271
7 SASI_Hs02_00330250 predicted 1377
8 SASI_Hs02_00330251 predicted 1317
9 SASI_Hs02_00330252 predicted 1479
10 SASI_Hs02_00330253 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330254 predicted 1494
2 SASI_Hs02_00330255 predicted 1080
3 SASI_Hs02_00330256 predicted 1469
4 SASI_Hs02_00330257 predicted 1532
5 SASI_Hs02_00330258 predicted 1898
6 SASI_Hs02_00330259 predicted 1294
7 SASI_Hs02_00330260 predicted 1394
8 SASI_Hs02_00330261 predicted 1340
9 SASI_Hs02_00330262 predicted 1494
10 SASI_Hs02_00330263 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330264 predicted 1286
2 SASI_Hs02_00330265 predicted 872
3 SASI_Hs02_00330266 predicted 1262
4 SASI_Hs02_00330267 predicted 1321
5 SASI_Hs02_00330268 predicted 1687
6 SASI_Hs02_00330269 predicted 1083
7 SASI_Hs02_00330270 predicted 1184
8 SASI_Hs02_00330271 predicted 1129
9 SASI_Hs02_00330272 predicted 1288
10 SASI_Hs02_00330273 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330274 predicted 1284
2 SASI_Hs02_00330275 predicted 861
3 SASI_Hs02_00330276 predicted 1263
4 SASI_Hs02_00330277 predicted 1322
5 SASI_Hs02_00330278 predicted 1688
6 SASI_Hs02_00330279 predicted 1080
7 SASI_Hs02_00330280 predicted 1186
8 SASI_Hs02_00330281 predicted 1126
9 SASI_Hs02_00330282 predicted 1284
10 SASI_Hs02_00330283 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115620 predicted 803
2 SASI_Rn01_00115621 predicted 979
3 SASI_Rn01_00115622 predicted 890
4 SASI_Rn01_00115623 predicted 438
5 SASI_Rn01_00115624 predicted 918
6 SASI_Rn01_00115625 predicted 761
7 SASI_Rn01_00115626 predicted 800
8 SASI_Rn01_00115627 predicted 571
9 SASI_Rn01_00115628 predicted 1244
10 SASI_Rn01_00115629 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000295
SERPINA1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-1154s1c1
Sequence:CCGGGCCAGCTTACATTTACCCAAACTCGAGTTTGGGTAAATGTAAGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-433s1c1
Sequence:CCGGCCAGTCCAACAGCACCAATATCTCGAGATATTGGTGCTGTTGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-1024s1c1
Sequence:CCGGGCTGATGAAATACCTGGGCAACTCGAGTTGCCCAGGTATTTCATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-956s1c1
Sequence:CCGGGTGCCTATGATGAAGCGTTTACTCGAGTAAACGCTTCATCATAGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-761s1c1
Sequence:CCGGGCCAAGAAACAGATCAACGATCTCGAGATCGTTGATCTGTTTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-1343s21c1
Sequence:CCGGTGCTGACCATCGACGAGAAAGCTCGAGCTTTCTCGTCGATGGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-540s21c1
Sequence:CCGGGGCTGACACTCACGATGAAATCTCGAGATTTCATCGTGAGTGTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-1243s21c1
Sequence:CCGGGGTCAACTGGGCATCACTAAGCTCGAGCTTAGTGATGCCCAGTTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000295
SERPINA1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-1154s1c1
Sequence:CCGGGCCAGCTTACATTTACCCAAACTCGAGTTTGGGTAAATGTAAGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-433s1c1
Sequence:CCGGCCAGTCCAACAGCACCAATATCTCGAGATATTGGTGCTGTTGGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-1024s1c1
Sequence:CCGGGCTGATGAAATACCTGGGCAACTCGAGTTGCCCAGGTATTTCATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-956s1c1
Sequence:CCGGGTGCCTATGATGAAGCGTTTACTCGAGTAAACGCTTCATCATAGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-761s1c1
Sequence:CCGGGCCAAGAAACAGATCAACGATCTCGAGATCGTTGATCTGTTTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-1343s21c1
Sequence:CCGGTGCTGACCATCGACGAGAAAGCTCGAGCTTTCTCGTCGATGGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-540s21c1
Sequence:CCGGGGCTGACACTCACGATGAAATCTCGAGATTTCATCGTGAGTGTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-1243s21c1
Sequence:CCGGGGTCAACTGGGCATCACTAAGCTCGAGCTTAGTGATGCCCAGTTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000295
SERPINA1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-1154s1c1
Sequence:CCGGGCCAGCTTACATTTACCCAAACTCGAGTTTGGGTAAATGTAAGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-433s1c1
Sequence:CCGGCCAGTCCAACAGCACCAATATCTCGAGATATTGGTGCTGTTGGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-1024s1c1
Sequence:CCGGGCTGATGAAATACCTGGGCAACTCGAGTTGCCCAGGTATTTCATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-956s1c1
Sequence:CCGGGTGCCTATGATGAAGCGTTTACTCGAGTAAACGCTTCATCATAGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000295.2-761s1c1
Sequence:CCGGGCCAAGAAACAGATCAACGATCTCGAGATCGTTGATCTGTTTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-1343s21c1
Sequence:CCGGTGCTGACCATCGACGAGAAAGCTCGAGCTTTCTCGTCGATGGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-540s21c1
Sequence:CCGGGGCTGACACTCACGATGAAATCTCGAGATTTCATCGTGAGTGTCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000295.4-1243s21c1
Sequence:CCGGGGTCAACTGGGCATCACTAAGCTCGAGCTTAGTGATGCCCAGTTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)