EMAIL THIS PAGE TO A FRIEND

SERPINA3

serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3

23 Gene Product Result for
Synonyms: AACT ACT GIG25
Gene ID:
Human(12) Summary: The protein encoded by this gene is a plasma protease inhibitor and member of the serine protease inhibitor class. Polymorphisms in this protein appear to be tissue specific and influence protease targeting. Variations in this protein's sequence have been implicated in Alzheimer's disease, and deficiency of this protein has been associated with liver disease. Mutations have been identified in patients with Parkinson disease and chronic obstructive pulmonary disease. [provided by RefSeq, Jul 2008]
chicken(772339) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
domestic cat(101089197) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
dog(480425) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
domestic guinea pig(100726710) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
naked mole-rat(101719778) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
cow(617667) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150301 MISSION® esiRNA esiRNA human SERPINA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226350 predicted 401
2 SASI_Hs01_00226351 predicted 1149
3 SASI_Hs01_00226352 predicted 610
4 SASI_Hs01_00226353 predicted 490
5 SASI_Hs01_00226354 predicted 788
6 SASI_Hs01_00226355 predicted 899
7 SASI_Hs01_00226356 predicted 991
8 SASI_Hs01_00226357 predicted 1036
9 SASI_Hs01_00226358 predicted 595
10 SASI_Hs01_00226359 predicted 1221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085
VALIDATED
SERPINA3 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085.4-486s21c1
Sequence:CCGGGTATGGGAAATGCCATGTTTGCTCGAGCAAACATGGCATTTCCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-1334s1c1
Sequence:CCGGTGGAATGCAAGCTGGATGCCTCTCGAGAGGCATCCAGCTTGCATTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001085.2-229s1c1
Sequence:CCGGCCTTGATAAGAATGTCATCTTCTCGAGAAGATGACATTCTTATCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085.4-1041s21c1
Sequence:CCGGACTATAACCTGAACGACATACCTCGAGGTATGTCGTTCAGGTTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-693s1c1
Sequence:CCGGCCCAAGATACTCATCAGTCAACTCGAGTTGACTGATGAGTATCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-763s1c1
Sequence:CCGGGCATCACCTGACTATACCTTACTCGAGTAAGGTATAGTCAGGTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085.4-206s21c1
Sequence:CCGGACACACGTGGACCTCGGATTACTCGAGTAATCCGAGGTCCACGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085.4-1138s21c1
Sequence:CCGGAGTCTCCCAGGTGGTCCATAACTCGAGTTATGGACCACCTGGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085
VALIDATED
SERPINA3 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085.4-486s21c1
Sequence:CCGGGTATGGGAAATGCCATGTTTGCTCGAGCAAACATGGCATTTCCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-1334s1c1
Sequence:CCGGTGGAATGCAAGCTGGATGCCTCTCGAGAGGCATCCAGCTTGCATTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001085.2-229s1c1
Sequence:CCGGCCTTGATAAGAATGTCATCTTCTCGAGAAGATGACATTCTTATCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085.4-1041s21c1
Sequence:CCGGACTATAACCTGAACGACATACCTCGAGGTATGTCGTTCAGGTTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-693s1c1
Sequence:CCGGCCCAAGATACTCATCAGTCAACTCGAGTTGACTGATGAGTATCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-763s1c1
Sequence:CCGGGCATCACCTGACTATACCTTACTCGAGTAAGGTATAGTCAGGTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085.4-206s21c1
Sequence:CCGGACACACGTGGACCTCGGATTACTCGAGTAATCCGAGGTCCACGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085.4-1138s21c1
Sequence:CCGGAGTCTCCCAGGTGGTCCATAACTCGAGTTATGGACCACCTGGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085
VALIDATED
SERPINA3 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085.4-486s21c1
Sequence:CCGGGTATGGGAAATGCCATGTTTGCTCGAGCAAACATGGCATTTCCCATACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-1334s1c1
Sequence:CCGGTGGAATGCAAGCTGGATGCCTCTCGAGAGGCATCCAGCTTGCATTCCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001085.2-229s1c1
Sequence:CCGGCCTTGATAAGAATGTCATCTTCTCGAGAAGATGACATTCTTATCAAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085.4-1041s21c1
Sequence:CCGGACTATAACCTGAACGACATACCTCGAGGTATGTCGTTCAGGTTATAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-693s1c1
Sequence:CCGGCCCAAGATACTCATCAGTCAACTCGAGTTGACTGATGAGTATCTTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001085.2-763s1c1
Sequence:CCGGGCATCACCTGACTATACCTTACTCGAGTAAGGTATAGTCAGGTGATGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085.4-206s21c1
Sequence:CCGGACACACGTGGACCTCGGATTACTCGAGTAATCCGAGGTCCACGTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085.4-1138s21c1
Sequence:CCGGAGTCTCCCAGGTGGTCCATAACTCGAGTTATGGACCACCTGGGAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???