EMAIL THIS PAGE TO A FRIEND

SERPINA4

serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4

34 Gene Product Result for
Synonyms: KAL KLST KST PI-4 PI4 kallistatin
UniProtKB ID: P29622, Q53XB5, Q86TR9, Q96BZ5
Gene ID:
Rat(246328) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
cow(786932) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
sheep(101118993) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
chicken(423433) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
domestic cat(101081642) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
dog(490840) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0524 AQUA Peptide LGFTDLFS[K] human pricing
AQ0525 AQUA Peptide VGSALFLSHNL[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006215 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078291 MISSION® esiRNA esiRNA human SERPINA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006215 Rosetta Predictions human pricing
NM_145097 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184392 predicted 644
2 SASI_Hs01_00184393 predicted 1026
3 SASI_Hs01_00184394 predicted 822
4 SASI_Hs01_00184395 predicted 963
5 SASI_Hs01_00184396 predicted 227
6 SASI_Hs02_00341124 predicted 729
7 SASI_Hs02_00341125 predicted 1100
8 SASI_Hs01_00184397 predicted 927
9 SASI_Hs01_00184399 predicted 549
10 SASI_Hs01_00184401 predicted 1266
11 SASI_Hs01_00184398 predicted 384
12 SASI_Hs01_00184400 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083301 predicted 1215
2 SASI_Rn01_00083302 predicted 1105
3 SASI_Rn01_00083303 predicted 525
4 SASI_Rn01_00083304 predicted 544
5 SASI_Rn01_00083305 predicted 519
6 SASI_Rn01_00083306 predicted 541
7 SASI_Rn01_00083307 predicted 1038
8 SASI_Rn02_00268694 predicted 794
9 SASI_Rn01_00083308 predicted 1010
10 SASI_Rn01_00083309 predicted 586
11 SASI_Rn01_00083310 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006215
SERPINA4 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-536s21c1
Sequence:CCGGATGACACCATGGCCGTCTATGCTCGAGCATAGACGGCCATGGTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-583s21c1
Sequence:CCGGTACGACACTGTGGGCACAATCCTCGAGGATTGTGCCCACAGTGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-1205s21c1
Sequence:CCGGCCACCAGCTTCGCGATCAAATCTCGAGATTTGATCGCGAAGCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006215.2-1412s21c1
Sequence:CCGGAGTAGCTCTGTGTTTAGAGTTCTCGAGAACTCTAAACACAGAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-856s21c1
Sequence:CCGGTCGGTGCTACGGATGGATTACCTCGAGGTAATCCATCCGTAGCACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-1270s1c1
Sequence:CCGGCCCTTCCTTGTGGTGATCTTTCTCGAGAAAGATCACCACAAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-690s1c1
Sequence:CCGGGCTGGTGAATTACATTTACTTCTCGAGAAGTAAATGTAATTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-717s1c1
Sequence:CCGGCCTGTGGGAGAAACCATTCATCTCGAGATGAATGGTTTCTCCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-954s1c1
Sequence:CCGGGATGCTAATGAGGTGGAACAACTCGAGTTGTTCCACCTCATTAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-248s1c1
Sequence:CCGGGCTTCTACTACCTGATCGCTTCTCGAGAAGCGATCAGGTAGTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006215
SERPINA4 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-536s21c1
Sequence:CCGGATGACACCATGGCCGTCTATGCTCGAGCATAGACGGCCATGGTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-583s21c1
Sequence:CCGGTACGACACTGTGGGCACAATCCTCGAGGATTGTGCCCACAGTGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-1205s21c1
Sequence:CCGGCCACCAGCTTCGCGATCAAATCTCGAGATTTGATCGCGAAGCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006215.2-1412s21c1
Sequence:CCGGAGTAGCTCTGTGTTTAGAGTTCTCGAGAACTCTAAACACAGAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-856s21c1
Sequence:CCGGTCGGTGCTACGGATGGATTACCTCGAGGTAATCCATCCGTAGCACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-1270s1c1
Sequence:CCGGCCCTTCCTTGTGGTGATCTTTCTCGAGAAAGATCACCACAAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-690s1c1
Sequence:CCGGGCTGGTGAATTACATTTACTTCTCGAGAAGTAAATGTAATTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-717s1c1
Sequence:CCGGCCTGTGGGAGAAACCATTCATCTCGAGATGAATGGTTTCTCCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-954s1c1
Sequence:CCGGGATGCTAATGAGGTGGAACAACTCGAGTTGTTCCACCTCATTAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-248s1c1
Sequence:CCGGGCTTCTACTACCTGATCGCTTCTCGAGAAGCGATCAGGTAGTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006215
SERPINA4 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-536s21c1
Sequence:CCGGATGACACCATGGCCGTCTATGCTCGAGCATAGACGGCCATGGTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-583s21c1
Sequence:CCGGTACGACACTGTGGGCACAATCCTCGAGGATTGTGCCCACAGTGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-1205s21c1
Sequence:CCGGCCACCAGCTTCGCGATCAAATCTCGAGATTTGATCGCGAAGCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006215.2-1412s21c1
Sequence:CCGGAGTAGCTCTGTGTTTAGAGTTCTCGAGAACTCTAAACACAGAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006215.2-856s21c1
Sequence:CCGGTCGGTGCTACGGATGGATTACCTCGAGGTAATCCATCCGTAGCACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-1270s1c1
Sequence:CCGGCCCTTCCTTGTGGTGATCTTTCTCGAGAAAGATCACCACAAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-690s1c1
Sequence:CCGGGCTGGTGAATTACATTTACTTCTCGAGAAGTAAATGTAATTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-717s1c1
Sequence:CCGGCCTGTGGGAGAAACCATTCATCTCGAGATGAATGGTTTCTCCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-954s1c1
Sequence:CCGGGATGCTAATGAGGTGGAACAACTCGAGTTGTTCCACCTCATTAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006215.2-248s1c1
Sequence:CCGGGCTTCTACTACCTGATCGCTTCTCGAGAAGCGATCAGGTAGTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)