EMAIL THIS PAGE TO A FRIEND

SERPINA6

serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6

85 Gene Product Result for
Synonyms: CBG
UniProtKB ID: P08185, A8K456, Q7Z2Q9
Gene ID:
Human(866) Summary: This gene encodes an alpha-globulin protein with corticosteroid-binding properties. This is the major transport protein for glucorticoids and progestins in the blood of most vertebrates. The gene localizes to a chromosomal region containing several closely related serine protease inhibitors which may have evolved by duplication events. [provided by RefSeq, Jul 2008]
Mouse(12401) serine (or cysteine) peptidase inhibitor, clade A, member 6
Rat(299270) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
dog(490838) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
domestic cat(101080642) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
cow(513746) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
sheep(101118224) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
N2390 19-Norprogesterone powder human pricing
D6875 21-Hydroxyprogesterone ≥97% (HPLC) human pricing
C2755 Cortisone ≥98% human pricing
H4126 Hydrocortisone 21-acetate ≥98% (HPLC) human pricing
H3035 Hydrocortisone 21-acetate meets USP testing specifications human pricing
54102 Hydrocortisone 21-acetate tested according to Ph Eur human pricing
A8380 5α-Androstan-17β-ol-3-one ≥97.5% human, mouse, rat pricing
E8875 β-Estradiol ≥98% human, mouse, rat pricing
E2758 β-Estradiol BioReagent, powder, suitable for cell culture human, mouse, rat pricing
E2257 β-Estradiol powder, γ-irradiated, suitable for cell culture human, mouse, rat pricing
E1132 β-Estradiol analytical standard human, mouse, rat pricing
E1024 Estradiol meets USP testing specifications human, mouse, rat pricing
E1253 Estriol ≥97% human, mouse, rat pricing
E1149 Estriol meets USP testing specifications human, mouse, rat pricing
E9750 Estrone ≥99% human, mouse, rat pricing
E1274 Estrone meets USP testing specifications human, mouse, rat pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
P6004 Prednisolone ≥99% human, mouse, rat pricing
P0130 Progesterone ≥99% human, mouse, rat pricing
P8783 Progesterone powder, BioReagent, suitable for cell culture human, mouse, rat pricing
P6149 Progesterone γ-irradiated, BioXtra, suitable for cell culture human, mouse, rat pricing
P3972 Progesterone meets USP testing specifications human, mouse, rat pricing
P7556 Progesterone-Water Soluble powder, BioReagent, suitable for cell culture human, mouse, rat pricing
T1500 Testosterone ≥98% human, mouse, rat pricing
T5411 Testosterone solution 1.0 mg/mL in 1,2-dimethoxyethane, drug standard human, mouse, rat pricing
H5752 17α-Hydroxyprogesterone ≥95% human, rat pricing
74640 19-Nortestosterone ≥99.0% (HPLC) human, rat pricing
N7252 19-Nortestosterone human, rat pricing
P9129 5-Pregnen-3β-ol-20-one ≥98% human, rat pricing
A9477 Aldosterone ≥95% (HPLC) human, rat pricing
C2505 Corticosterone ≥92% human, rat pricing
27840 Corticosterone ≥98.5% (HPLC) human, rat pricing
E5126 Etiocholan-3α-ol-17-one human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032381 MISSION® esiRNA esiRNA human SERPINA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001756 Rosetta Predictions human pricing
NM_001009663 Rosetta Predictions rat pricing
NM_007618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332480 predicted 1213
2 SASI_Hs01_00068525 predicted 1052
3 SASI_Hs01_00068526 predicted 535
4 SASI_Hs01_00068527 predicted 556
5 SASI_Hs02_00332481 predicted 1117
6 SASI_Hs01_00068529 predicted 991
7 SASI_Hs02_00332482 predicted 227
8 SASI_Hs01_00068532 predicted 931
9 SASI_Hs01_00068534 predicted 249
10 SASI_Hs02_00332483 predicted 403
11 SASI_Hs01_00068528 predicted 1219
12 SASI_Hs01_00068530 predicted 1022
13 SASI_Hs01_00068531 predicted 1084
14 SASI_Hs01_00068533 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199695 predicted 701
2 SASI_Rn01_00112061 predicted 949
3 SASI_Rn01_00112062 predicted 468
4 SASI_Rn01_00112063 predicted 965
5 SASI_Rn01_00112064 predicted 1047
6 SASI_Rn01_00112065 predicted 878
7 SASI_Rn01_00112066 predicted 1110
8 SASI_Rn01_00112067 predicted 525
9 SASI_Rn01_00112068 predicted 386
10 SASI_Rn01_00112069 predicted 430
11 SASI_Rn01_00112070 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089346 predicted 690
2 SASI_Mm01_00089347 predicted 1225
3 SASI_Mm01_00089348 predicted 1029
4 SASI_Mm01_00089349 predicted 787
5 SASI_Mm01_00089350 predicted 989
6 SASI_Mm01_00089351 predicted 1112
7 SASI_Mm01_00089352 predicted 451
8 SASI_Mm01_00089353 predicted 790
9 SASI_Mm01_00089354 predicted 471
10 SASI_Mm01_00089355 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001756
SERPINA6 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-941s21c1
Sequence:CCGGACTGAGCCGGGACACGATTAACTCGAGTTAATCGTGTCCCGGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-538s21c1
Sequence:CCGGCAGACATCAAGCACTACTATGCTCGAGCATAGTAGTGCTTGATGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-849s1c1
Sequence:CCGGCAGATGAACTACGTGGGCAATCTCGAGATTGCCCACGTAGTTCATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-860s1c1
Sequence:CCGGCGTGGGCAATGGGACTGTCTTCTCGAGAAGACAGTCCCATTGCCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-686s21c1
Sequence:CCGGCCTCGTCCTGGTCAACTATATCTCGAGATATAGTTGACCAGGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-794s1c1
Sequence:CCGGGCAGTCGAGCACCATCAGTTACTCGAGTAACTGATGGTGCTCGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-986s1c1
Sequence:CCGGGTACATTCCAAAGGTCACCATCTCGAGATGGTGACCTTTGGAATGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-1112s1c1
Sequence:CCGGGTCATCAAAGGTGGTCCATAACTCGAGTTATGGACCACCTTTGATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001756
SERPINA6 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-941s21c1
Sequence:CCGGACTGAGCCGGGACACGATTAACTCGAGTTAATCGTGTCCCGGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-538s21c1
Sequence:CCGGCAGACATCAAGCACTACTATGCTCGAGCATAGTAGTGCTTGATGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-849s1c1
Sequence:CCGGCAGATGAACTACGTGGGCAATCTCGAGATTGCCCACGTAGTTCATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-860s1c1
Sequence:CCGGCGTGGGCAATGGGACTGTCTTCTCGAGAAGACAGTCCCATTGCCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-686s21c1
Sequence:CCGGCCTCGTCCTGGTCAACTATATCTCGAGATATAGTTGACCAGGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-794s1c1
Sequence:CCGGGCAGTCGAGCACCATCAGTTACTCGAGTAACTGATGGTGCTCGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-986s1c1
Sequence:CCGGGTACATTCCAAAGGTCACCATCTCGAGATGGTGACCTTTGGAATGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-1112s1c1
Sequence:CCGGGTCATCAAAGGTGGTCCATAACTCGAGTTATGGACCACCTTTGATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001756
SERPINA6 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-941s21c1
Sequence:CCGGACTGAGCCGGGACACGATTAACTCGAGTTAATCGTGTCCCGGCTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-538s21c1
Sequence:CCGGCAGACATCAAGCACTACTATGCTCGAGCATAGTAGTGCTTGATGTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-849s1c1
Sequence:CCGGCAGATGAACTACGTGGGCAATCTCGAGATTGCCCACGTAGTTCATCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-860s1c1
Sequence:CCGGCGTGGGCAATGGGACTGTCTTCTCGAGAAGACAGTCCCATTGCCCACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001756.3-686s21c1
Sequence:CCGGCCTCGTCCTGGTCAACTATATCTCGAGATATAGTTGACCAGGACGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-794s1c1
Sequence:CCGGGCAGTCGAGCACCATCAGTTACTCGAGTAACTGATGGTGCTCGACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-986s1c1
Sequence:CCGGGTACATTCCAAAGGTCACCATCTCGAGATGGTGACCTTTGGAATGTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001756.x-1112s1c1
Sequence:CCGGGTCATCAAAGGTGGTCCATAACTCGAGTTATGGACCACCTTTGATGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007618
SERPINA6 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-466s1c1
Sequence:CCGGGCAGACACCAAACACTATTATCTCGAGATAATAGTGTTTGGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007618.1-1274s1c1
Sequence:CCGGCCATCTGACTTTGAGAGCATACTCGAGTATGCTCTCAAAGTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-1146s1c1
Sequence:CCGGCGAATCATTCACCCTCAAGTACTCGAGTACTTGAGGGTGAATGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-793s1c1
Sequence:CCGGCAGATGAATTATGTGGGAAATCTCGAGATTTCCCACATAATTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-742s1c1
Sequence:CCGGTCAGGCAACATTAGTTACTTTCTCGAGAAAGTAACTAATGTTGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007618
SERPINA6 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-466s1c1
Sequence:CCGGGCAGACACCAAACACTATTATCTCGAGATAATAGTGTTTGGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007618.1-1274s1c1
Sequence:CCGGCCATCTGACTTTGAGAGCATACTCGAGTATGCTCTCAAAGTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-1146s1c1
Sequence:CCGGCGAATCATTCACCCTCAAGTACTCGAGTACTTGAGGGTGAATGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-793s1c1
Sequence:CCGGCAGATGAATTATGTGGGAAATCTCGAGATTTCCCACATAATTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-742s1c1
Sequence:CCGGTCAGGCAACATTAGTTACTTTCTCGAGAAAGTAACTAATGTTGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007618
SERPINA6 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-466s1c1
Sequence:CCGGGCAGACACCAAACACTATTATCTCGAGATAATAGTGTTTGGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007618.1-1274s1c1
Sequence:CCGGCCATCTGACTTTGAGAGCATACTCGAGTATGCTCTCAAAGTCAGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-1146s1c1
Sequence:CCGGCGAATCATTCACCCTCAAGTACTCGAGTACTTGAGGGTGAATGATTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-793s1c1
Sequence:CCGGCAGATGAATTATGTGGGAAATCTCGAGATTTCCCACATAATTCATCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007618.1-742s1c1
Sequence:CCGGTCAGGCAACATTAGTTACTTTCTCGAGAAAGTAACTAATGTTGCCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)