EMAIL THIS PAGE TO A FRIEND

SERPINB2

serpin peptidase inhibitor, clade B (ovalbumin), member 2

51 Gene Product Result for
Synonyms: HsT1201 PAI PAI-2 PAI2 PLANH2
UniProtKB ID: P05120, Q96E96
Gene ID:
Mouse(18788) serine (or cysteine) peptidase inhibitor, clade B, member 2
Rat(60325) serpin peptidase inhibitor, clade B (ovalbumin), member 2
chicken(420896) serpin peptidase inhibitor, clade B (ovalbumin), member 2
domestic cat(101085412) serpin peptidase inhibitor, clade B (ovalbumin), member 2
Horse(100051584) serpin peptidase inhibitor, clade B (ovalbumin), member 2
dog(609604) serpin peptidase inhibitor, clade B (ovalbumin), member 2
cow(505184) serpin peptidase inhibitor, clade B (ovalbumin), member 2
cow(281376) serpin peptidase inhibitor, clade B (ovalbumin), member 2
sheep(100381268) serpin peptidase inhibitor, clade B (ovalbumin), member 2
sheep(101105044) serpin peptidase inhibitor, clade B (ovalbumin), member 2
domestic guinea pig(100722462) serpin peptidase inhibitor, clade B (ovalbumin), member 2
naked mole-rat(101718744) serpin peptidase inhibitor, clade B (ovalbumin), member 2
Domestic Rabbit(100216509) serpin peptidase inhibitor, clade B (ovalbumin), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002791 MISSION® esiRNA esiRNA targeting human SERPINB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002575 Rosetta Predictions human pricing
NM_021696 Rosetta Predictions rat pricing
NM_011111 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120712 predicted 1190
2 SASI_Hs01_00120713 predicted 330
3 SASI_Hs01_00120714 predicted 327
4 SASI_Hs02_00334073 predicted 789
5 SASI_Hs01_00120715 predicted 419
6 SASI_Hs01_00120716 predicted 547
7 SASI_Hs01_00120717 predicted 422
8 SASI_Hs01_00120718 predicted 1029
9 SASI_Hs01_00120719 predicted 542
10 SASI_Hs01_00120720 predicted 1030
11 SASI_Hs01_00120721 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073692 predicted 443
2 SASI_Rn01_00073693 predicted 269
3 SASI_Rn01_00073694 predicted 875
4 SASI_Rn01_00073695 predicted 1220
5 SASI_Rn01_00073696 predicted 939
6 SASI_Rn01_00073697 predicted 741
7 SASI_Rn01_00073698 predicted 780
8 SASI_Rn01_00073699 predicted 784
9 SASI_Rn01_00073700 predicted 1174
10 SASI_Rn02_00262737 predicted 874
11 SASI_Rn01_00073701 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076142 predicted 1257
2 SASI_Mm01_00076143 predicted 915
3 SASI_Mm01_00076144 predicted 1147
4 SASI_Mm01_00076146 predicted 937
5 SASI_Mm01_00076148 predicted 462
6 SASI_Mm01_00076149 predicted 849
7 SASI_Mm01_00076150 predicted 753
8 SASI_Mm01_00076151 predicted 706
9 SASI_Mm02_00319928 predicted 244
10 SASI_Mm02_00319929 predicted 390
11 SASI_Mm01_00076145 predicted 246
12 SASI_Mm01_00076147 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002575
SERPINB2 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade B (ovalbumin), member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-915s1c1
Sequence:CCGGGCTGGAAAGTGAAATAACCTACTCGAGTAGGTTATTTCACTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002575.2-1635s21c1
Sequence:CCGGTTATTGCTCACTGCCTATTTACTCGAGTAAATAGGCAGTGAGCAATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-726s1c1
Sequence:CCGGGCTTTATCCTTTCCGTGTAAACTCGAGTTTACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-321s1c1
Sequence:CCGGGCAGATCCAGAAGGGTAGTTACTCGAGTAACTACCCTTCTGGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-425s1c1
Sequence:CCGGCAGGGAATTATTTACTGGAAACTCGAGTTTCCAGTAAATAATTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-1228s1c1
Sequence:CCGGCCACAGTTTGTGGCAGATCATCTCGAGATGATCTGCCACAAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002575.2-1074s21c1
Sequence:CCGGCAACAAGGGACGGGCCAATTTCTCGAGAAATTGGCCCGTCCCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002575.2-1495s21c1
Sequence:CCGGATAACATGACAACCCTATTAACTCGAGTTAATAGGGTTGTCATGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002575
SERPINB2 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade B (ovalbumin), member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-915s1c1
Sequence:CCGGGCTGGAAAGTGAAATAACCTACTCGAGTAGGTTATTTCACTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002575.2-1635s21c1
Sequence:CCGGTTATTGCTCACTGCCTATTTACTCGAGTAAATAGGCAGTGAGCAATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-726s1c1
Sequence:CCGGGCTTTATCCTTTCCGTGTAAACTCGAGTTTACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-321s1c1
Sequence:CCGGGCAGATCCAGAAGGGTAGTTACTCGAGTAACTACCCTTCTGGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-425s1c1
Sequence:CCGGCAGGGAATTATTTACTGGAAACTCGAGTTTCCAGTAAATAATTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-1228s1c1
Sequence:CCGGCCACAGTTTGTGGCAGATCATCTCGAGATGATCTGCCACAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002575.2-1074s21c1
Sequence:CCGGCAACAAGGGACGGGCCAATTTCTCGAGAAATTGGCCCGTCCCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002575.2-1495s21c1
Sequence:CCGGATAACATGACAACCCTATTAACTCGAGTTAATAGGGTTGTCATGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002575
SERPINB2 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade B (ovalbumin), member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-915s1c1
Sequence:CCGGGCTGGAAAGTGAAATAACCTACTCGAGTAGGTTATTTCACTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002575.2-1635s21c1
Sequence:CCGGTTATTGCTCACTGCCTATTTACTCGAGTAAATAGGCAGTGAGCAATAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-726s1c1
Sequence:CCGGGCTTTATCCTTTCCGTGTAAACTCGAGTTTACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-321s1c1
Sequence:CCGGGCAGATCCAGAAGGGTAGTTACTCGAGTAACTACCCTTCTGGATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-425s1c1
Sequence:CCGGCAGGGAATTATTTACTGGAAACTCGAGTTTCCAGTAAATAATTCCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002575.1-1228s1c1
Sequence:CCGGCCACAGTTTGTGGCAGATCATCTCGAGATGATCTGCCACAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002575.2-1074s21c1
Sequence:CCGGCAACAAGGGACGGGCCAATTTCTCGAGAAATTGGCCCGTCCCTTGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002575.2-1495s21c1
Sequence:CCGGATAACATGACAACCCTATTAACTCGAGTTAATAGGGTTGTCATGTTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011111
VALIDATED
SERPINB2 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade B (ovalbumin), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-203s1c1
Sequence:CCGGGCAGTTATGGTATCACCACAACTCGAGTTGTGGTGATACCATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-1168s1c1
Sequence:CCGGCCACAGTTTGTGGCCGATCATCTCGAGATGATCGGCCACAAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011111.2-767s1c1
Sequence:CCGGAGATCCTAGAACTTCCGCATACTCGAGTATGCGGAAGTTCTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011111.2-568s1c1
Sequence:CCGGCCCGAAGGTTCTGTAGATGAACTCGAGTTCATCTACAGAACCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-666s1c1
Sequence:CCGGGCTTTATCCTTTCCGTGTGAACTCGAGTTCACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-755s21c1
Sequence:CCGGAGATCCTAGAACTTCCGCATACTCGAGTATGCGGAAGTTCTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-1204s21c1
Sequence:CCGGATTACCCACACGATACTATTTCTCGAGAAATAGTATCGTGTGGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-1407s21c1
Sequence:CCGGTGCTTACAGTATAACTCTATTCTCGAGAATAGAGTTATACTGTAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-556s21c1
Sequence:CCGGCCCGAAGGTTCTGTAGATGAACTCGAGTTCATCTACAGAACCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-654s21c1
Sequence:CCGGGCTTTATCCTTTCCGTGTGAACTCGAGTTCACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011111
VALIDATED
SERPINB2 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade B (ovalbumin), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-203s1c1
Sequence:CCGGGCAGTTATGGTATCACCACAACTCGAGTTGTGGTGATACCATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-1168s1c1
Sequence:CCGGCCACAGTTTGTGGCCGATCATCTCGAGATGATCGGCCACAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011111.2-767s1c1
Sequence:CCGGAGATCCTAGAACTTCCGCATACTCGAGTATGCGGAAGTTCTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011111.2-568s1c1
Sequence:CCGGCCCGAAGGTTCTGTAGATGAACTCGAGTTCATCTACAGAACCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-666s1c1
Sequence:CCGGGCTTTATCCTTTCCGTGTGAACTCGAGTTCACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-755s21c1
Sequence:CCGGAGATCCTAGAACTTCCGCATACTCGAGTATGCGGAAGTTCTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-1204s21c1
Sequence:CCGGATTACCCACACGATACTATTTCTCGAGAAATAGTATCGTGTGGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-1407s21c1
Sequence:CCGGTGCTTACAGTATAACTCTATTCTCGAGAATAGAGTTATACTGTAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-556s21c1
Sequence:CCGGCCCGAAGGTTCTGTAGATGAACTCGAGTTCATCTACAGAACCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-654s21c1
Sequence:CCGGGCTTTATCCTTTCCGTGTGAACTCGAGTTCACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011111
VALIDATED
SERPINB2 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade B (ovalbumin), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-203s1c1
Sequence:CCGGGCAGTTATGGTATCACCACAACTCGAGTTGTGGTGATACCATAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-1168s1c1
Sequence:CCGGCCACAGTTTGTGGCCGATCATCTCGAGATGATCGGCCACAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011111.2-767s1c1
Sequence:CCGGAGATCCTAGAACTTCCGCATACTCGAGTATGCGGAAGTTCTAGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011111.2-568s1c1
Sequence:CCGGCCCGAAGGTTCTGTAGATGAACTCGAGTTCATCTACAGAACCTTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011111.2-666s1c1
Sequence:CCGGGCTTTATCCTTTCCGTGTGAACTCGAGTTCACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-755s21c1
Sequence:CCGGAGATCCTAGAACTTCCGCATACTCGAGTATGCGGAAGTTCTAGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-1204s21c1
Sequence:CCGGATTACCCACACGATACTATTTCTCGAGAAATAGTATCGTGTGGGTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-1407s21c1
Sequence:CCGGTGCTTACAGTATAACTCTATTCTCGAGAATAGAGTTATACTGTAAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-556s21c1
Sequence:CCGGCCCGAAGGTTCTGTAGATGAACTCGAGTTCATCTACAGAACCTTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011111.3-654s21c1
Sequence:CCGGGCTTTATCCTTTCCGTGTGAACTCGAGTTCACACGGAAAGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)