EMAIL THIS PAGE TO A FRIEND

SERPINB7

serpin peptidase inhibitor, clade B (ovalbumin), member 7

62 Gene Product Result for
Synonyms: MEGSIN TP55
UniProtKB ID: O75635, B4DUW8, F5GZC0, Q1ED45, Q3KPG4
Gene ID:
Mouse(116872) serine (or cysteine) peptidase inhibitor, clade B, member 7
Rat(117092) serpin peptidase inhibitor, clade B (ovalbumin), member 7
domestic guinea pig(100730482) serpin peptidase inhibitor, clade B (ovalbumin), member 7
naked mole-rat(101706543) serpin peptidase inhibitor, clade B (ovalbumin), member 7
Domestic Rabbit(100328647) serpin peptidase inhibitor, clade B (ovalbumin), member 7
cow(513568) serpin peptidase inhibitor, clade B (ovalbumin), member 7
sheep(101104624) serpin peptidase inhibitor, clade B (ovalbumin), member 7
domestic cat(101085000) serpin peptidase inhibitor, clade B (ovalbumin), member 7
Horse(100051511) serpin peptidase inhibitor, clade B (ovalbumin), member 7
dog(483952) serpin peptidase inhibitor, clade B (ovalbumin), member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040147 Rosetta Predictions human pricing
NM_003784 Rosetta Predictions human pricing
NM_130404 Rosetta Predictions rat pricing
NM_027548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108691 predicted 924
2 SASI_Hs01_00108692 predicted 1203
3 SASI_Hs01_00108693 predicted 484
4 SASI_Hs01_00108694 predicted 290
5 SASI_Hs01_00108695 predicted 895
6 SASI_Hs01_00108696 predicted 1237
7 SASI_Hs01_00108698 predicted 426
8 SASI_Hs01_00108699 predicted 576
9 SASI_Hs02_00308856 predicted 495
10 SASI_Hs01_00108700 predicted 977
11 SASI_Hs01_00108697 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179075 predicted 1184
2 SASI_Hs01_00179076 predicted 1463
3 SASI_Hs01_00179077 predicted 738
4 SASI_Hs01_00179078 predicted 555
5 SASI_Hs01_00179079 predicted 1153
6 SASI_Hs01_00179080 predicted 1497
7 SASI_Hs01_00179082 predicted 689
8 SASI_Hs01_00179083 predicted 837
9 SASI_Hs02_00336285 predicted 755
10 SASI_Hs01_00179084 predicted 1241
11 SASI_Hs01_00179081 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062552 predicted 541
2 SASI_Rn01_00062553 predicted 260
3 SASI_Rn01_00062554 predicted 263
4 SASI_Rn01_00062555 predicted 793
5 SASI_Rn02_00267391 predicted 775
6 SASI_Rn01_00062556 predicted 669
7 SASI_Rn01_00062557 predicted 510
8 SASI_Rn01_00062558 predicted 252
9 SASI_Rn01_00062560 predicted 335
10 SASI_Rn01_00062561 predicted 632
11 SASI_Rn01_00062559 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101037 predicted 319
2 SASI_Mm01_00101038 predicted 597
3 SASI_Mm01_00101039 predicted 1305
4 SASI_Mm01_00101040 predicted 434
5 SASI_Mm01_00101041 predicted 909
6 SASI_Mm01_00101042 predicted 281
7 SASI_Mm01_00101043 predicted 745
8 SASI_Mm01_00101044 predicted 928
9 SASI_Mm02_00332391 predicted 818
10 SASI_Mm02_00332392 predicted 263
11 SASI_Mm01_00101036 predicted 904
12 SASI_Mm01_00101045 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003784
SERPINB7 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade B (ovalbumin), member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-629s1c1
Sequence:CCGGGCATCCCACAAGGATTATGATCTCGAGATCATAATCCTTGTGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-514s1c1
Sequence:CCGGCCTCTCTCAGATTGATAAGTTCTCGAGAACTTATCAATCTGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-746s1c1
Sequence:CCGGCGAGTTGACTTTACGAATCATCTCGAGATGATTCGTAAAGTCAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-1167s1c1
Sequence:CCGGCCTCTAAGTATGTTGAGGTATCTCGAGATACCTCAACATACTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-1427s21c1
Sequence:CCCGCTGACCACCCATTCCTATTTGCTCGAGCAAATAGGAATGGGTGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-1045s21c1
Sequence:CCGGAGATACAATGGTGGCATAAACCTCGAGGTTTATGCCACCATTGTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-761s21c1
Sequence:CCGGTAGAAGACACTAGACGTAATACTCGAGTATTACGTCTAGTGTCTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003784.2-1743s21c1
Sequence:CCGGCCACGCTCATTTCTATCATTCCTCGAGGAATGATAGAAATGAGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003784
SERPINB7 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade B (ovalbumin), member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-629s1c1
Sequence:CCGGGCATCCCACAAGGATTATGATCTCGAGATCATAATCCTTGTGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-514s1c1
Sequence:CCGGCCTCTCTCAGATTGATAAGTTCTCGAGAACTTATCAATCTGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-746s1c1
Sequence:CCGGCGAGTTGACTTTACGAATCATCTCGAGATGATTCGTAAAGTCAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-1167s1c1
Sequence:CCGGCCTCTAAGTATGTTGAGGTATCTCGAGATACCTCAACATACTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-1427s21c1
Sequence:CCCGCTGACCACCCATTCCTATTTGCTCGAGCAAATAGGAATGGGTGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-1045s21c1
Sequence:CCGGAGATACAATGGTGGCATAAACCTCGAGGTTTATGCCACCATTGTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-761s21c1
Sequence:CCGGTAGAAGACACTAGACGTAATACTCGAGTATTACGTCTAGTGTCTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003784.2-1743s21c1
Sequence:CCGGCCACGCTCATTTCTATCATTCCTCGAGGAATGATAGAAATGAGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003784
SERPINB7 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade B (ovalbumin), member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-629s1c1
Sequence:CCGGGCATCCCACAAGGATTATGATCTCGAGATCATAATCCTTGTGGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-514s1c1
Sequence:CCGGCCTCTCTCAGATTGATAAGTTCTCGAGAACTTATCAATCTGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-746s1c1
Sequence:CCGGCGAGTTGACTTTACGAATCATCTCGAGATGATTCGTAAAGTCAACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003784.1-1167s1c1
Sequence:CCGGCCTCTAAGTATGTTGAGGTATCTCGAGATACCTCAACATACTTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-1427s21c1
Sequence:CCCGCTGACCACCCATTCCTATTTGCTCGAGCAAATAGGAATGGGTGGTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-1045s21c1
Sequence:CCGGAGATACAATGGTGGCATAAACCTCGAGGTTTATGCCACCATTGTATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003784.2-761s21c1
Sequence:CCGGTAGAAGACACTAGACGTAATACTCGAGTATTACGTCTAGTGTCTTCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003784.2-1743s21c1
Sequence:CCGGCCACGCTCATTTCTATCATTCCTCGAGGAATGATAGAAATGAGCGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027548
SERPINB7 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade B (ovalbumin), member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-585s1c1
Sequence:CCGGGCTGTTTACTTCAAAGGCAAACTCGAGTTTGCCTTTGAAGTAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-318s1c1
Sequence:CCGGGCTGACATAAACTCATCTCATCTCGAGATGAGATGAGTTTATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-702s1c1
Sequence:CCGGCGGTTCAATTTGTCTACCATTCTCGAGAATGGTAGACAAATTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027548.1-1323s1c1
Sequence:CCGGGCAAATGATACTGGTGACTTACTCGAGTAAGTCACCAGTATCATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-896s1c1
Sequence:CCGGCCAGTTCAAGATAGAGAAGAACTCGAGTTCTTCTCTATCTTGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027548
SERPINB7 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade B (ovalbumin), member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-585s1c1
Sequence:CCGGGCTGTTTACTTCAAAGGCAAACTCGAGTTTGCCTTTGAAGTAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-318s1c1
Sequence:CCGGGCTGACATAAACTCATCTCATCTCGAGATGAGATGAGTTTATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-702s1c1
Sequence:CCGGCGGTTCAATTTGTCTACCATTCTCGAGAATGGTAGACAAATTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027548.1-1323s1c1
Sequence:CCGGGCAAATGATACTGGTGACTTACTCGAGTAAGTCACCAGTATCATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-896s1c1
Sequence:CCGGCCAGTTCAAGATAGAGAAGAACTCGAGTTCTTCTCTATCTTGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027548
SERPINB7 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade B (ovalbumin), member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-585s1c1
Sequence:CCGGGCTGTTTACTTCAAAGGCAAACTCGAGTTTGCCTTTGAAGTAAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-318s1c1
Sequence:CCGGGCTGACATAAACTCATCTCATCTCGAGATGAGATGAGTTTATGTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-702s1c1
Sequence:CCGGCGGTTCAATTTGTCTACCATTCTCGAGAATGGTAGACAAATTGAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027548.1-1323s1c1
Sequence:CCGGGCAAATGATACTGGTGACTTACTCGAGTAAGTCACCAGTATCATTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027548.1-896s1c1
Sequence:CCGGCCAGTTCAAGATAGAGAAGAACTCGAGTTCTTCTCTATCTTGAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)