EMAIL THIS PAGE TO A FRIEND

SERPINF1

serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1

55 Gene Product Result for
Synonyms: EPC-1 OI12 OI6 PEDF
Gene ID:
Human(5176) Summary: The protein encoded by this gene is a member of the serpin family, although it does not display the serine protease inhibitory activity shown by many of the other serpin family members. The encoded protein is secreted and strongly inhibits angiogenesis. In addition, this protein is a neurotrophic factor involved in neuronal differentiation in retinoblastoma cells.[provided by RefSeq, Mar 2011]
Mouse(20317) serine (or cysteine) peptidase inhibitor, clade F, member 1
Rat(287526) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Zebrafish(447800) serine (or cysteine) peptidase inhibitor, clade F, member 1
dog(611276) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
domestic cat(101099915) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Horse(100072415) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
chicken(417561) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
naked mole-rat(101697774) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
domestic guinea pig(100216362) serine (or cysteine) peptidase inhibitor, clade F, member 1
cow(281386) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
sheep(100192425) serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0536 AQUA Peptide LSYEGEVT[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002615 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002615 Rosetta Predictions human pricing
NM_177927 Rosetta Predictions rat pricing
NM_011340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149978 predicted 968
2 SASI_Hs01_00149979 predicted 673
3 SASI_Hs01_00149981 predicted 1155
4 SASI_Hs01_00149983 predicted 1298
5 SASI_Hs01_00149984 predicted 1196
6 SASI_Hs01_00149985 predicted 750
7 SASI_Hs02_00334129 predicted 1206
8 SASI_Hs01_00149986 predicted 444
9 SASI_Hs01_00149987 predicted 503
10 SASI_Hs02_00334130 predicted 827
11 SASI_Hs01_00149980 predicted 517
12 SASI_Hs01_00149982 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046416 predicted 219
2 SASI_Rn01_00046417 predicted 358
3 SASI_Rn01_00046418 predicted 841
4 SASI_Rn01_00046419 predicted 1015
5 SASI_Rn01_00046420 predicted 1182
6 SASI_Rn01_00046421 predicted 932
7 SASI_Rn01_00046422 predicted 244
8 SASI_Rn01_00046423 predicted 1083
9 SASI_Rn01_00046424 predicted 689
10 SASI_Rn01_00046425 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153940 predicted 310
2 SASI_Mm02_00320472 predicted 1274
3 SASI_Mm01_00153941 predicted 932
4 SASI_Mm01_00153943 predicted 864
5 SASI_Mm02_00320473 predicted 942
6 SASI_Mm01_00153944 predicted 650
7 SASI_Mm01_00153945 predicted 924
8 SASI_Mm01_00153946 predicted 434
9 SASI_Mm02_00320474 predicted 1023
10 SASI_Mm01_00153949 predicted 698
11 SASI_Mm01_00153942 predicted 1082
12 SASI_Mm01_00153947 predicted 1324
13 SASI_Mm01_00153948 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011340
VALIDATED
SERPINF1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1277s21c1
Sequence:CCGGTCACCTTCCCGCTAGACTATCCTCGAGGATAGTCTAGCGGGAAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1127s21c1
Sequence:CCGGTGAAGCTACAGTCGTTGTTTGCTCGAGCAAACAACGACTGTAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1089s21c1
Sequence:CCGGGAGCTTCGAAGGCGAACTTACCTCGAGGTAAGTTCGCCTTCGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-577s21c1
Sequence:CCGGCGAGTCAAATCCAGCTTTGTTCTCGAGAACAAAGCTGGATTTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1151s21c1
Sequence:CCGGCACCCGACTTCAGCAAGATTACTCGAGTAATCTTGCTGAAGTCGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011340.2-1490s1c1
Sequence:CCGGGCTCTGCCAAAGTCACCATTTCTCGAGAAATGGTGACTTTGGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011340.2-475s1c1
Sequence:CCGGCGAGTCAAATCCAGCTTTGTTCTCGAGAACAAAGCTGGATTTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011340.2-1182s1c1
Sequence:CCGGCCCGCTAGACTATCACCTTAACTCGAGTTAAGGTGATAGTCTAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011340.2-1245s1c1
Sequence:CCGGCCTCCTCTTCATAGGCAGAATCTCGAGATTCTGCCTATGAAGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011340.2-472s1c1
Sequence:CCGGCTTCGAGTCAAATCCAGCTTTCTCGAGAAAGCTGGATTTGACTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011340
VALIDATED
SERPINF1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1277s21c1
Sequence:CCGGTCACCTTCCCGCTAGACTATCCTCGAGGATAGTCTAGCGGGAAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1127s21c1
Sequence:CCGGTGAAGCTACAGTCGTTGTTTGCTCGAGCAAACAACGACTGTAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1089s21c1
Sequence:CCGGGAGCTTCGAAGGCGAACTTACCTCGAGGTAAGTTCGCCTTCGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-577s21c1
Sequence:CCGGCGAGTCAAATCCAGCTTTGTTCTCGAGAACAAAGCTGGATTTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1151s21c1
Sequence:CCGGCACCCGACTTCAGCAAGATTACTCGAGTAATCTTGCTGAAGTCGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011340.2-1490s1c1
Sequence:CCGGGCTCTGCCAAAGTCACCATTTCTCGAGAAATGGTGACTTTGGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011340.2-475s1c1
Sequence:CCGGCGAGTCAAATCCAGCTTTGTTCTCGAGAACAAAGCTGGATTTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011340.2-1182s1c1
Sequence:CCGGCCCGCTAGACTATCACCTTAACTCGAGTTAAGGTGATAGTCTAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011340.2-1245s1c1
Sequence:CCGGCCTCCTCTTCATAGGCAGAATCTCGAGATTCTGCCTATGAAGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011340.2-472s1c1
Sequence:CCGGCTTCGAGTCAAATCCAGCTTTCTCGAGAAAGCTGGATTTGACTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011340
VALIDATED
SERPINF1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1277s21c1
Sequence:CCGGTCACCTTCCCGCTAGACTATCCTCGAGGATAGTCTAGCGGGAAGGTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1127s21c1
Sequence:CCGGTGAAGCTACAGTCGTTGTTTGCTCGAGCAAACAACGACTGTAGCTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1089s21c1
Sequence:CCGGGAGCTTCGAAGGCGAACTTACCTCGAGGTAAGTTCGCCTTCGAAGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-577s21c1
Sequence:CCGGCGAGTCAAATCCAGCTTTGTTCTCGAGAACAAAGCTGGATTTGACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011340.3-1151s21c1
Sequence:CCGGCACCCGACTTCAGCAAGATTACTCGAGTAATCTTGCTGAAGTCGGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011340.2-1490s1c1
Sequence:CCGGGCTCTGCCAAAGTCACCATTTCTCGAGAAATGGTGACTTTGGCAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011340.2-475s1c1
Sequence:CCGGCGAGTCAAATCCAGCTTTGTTCTCGAGAACAAAGCTGGATTTGACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011340.2-1182s1c1
Sequence:CCGGCCCGCTAGACTATCACCTTAACTCGAGTTAAGGTGATAGTCTAGCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011340.2-1245s1c1
Sequence:CCGGCCTCCTCTTCATAGGCAGAATCTCGAGATTCTGCCTATGAAGAGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011340.2-472s1c1
Sequence:CCGGCTTCGAGTCAAATCCAGCTTTCTCGAGAAAGCTGGATTTGACTCGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002615
VALIDATED
SERPINF1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-1100s21c1
Sequence:CCGGCCCAAGCTGAAGCTGAGTTATCTCGAGATAACTCAGCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-577s21c1
Sequence:CCGGCCGGATCGTCTTTGAGAAGAACTCGAGTTCTTCTCAAAGACGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-448s21c1
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002615.4-1041s21c1
Sequence:CCGGCCGAGTTCATTCATGACATAGCTCGAGCTATGTCATGAATGAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-964s21c1
Sequence:CCGGCGGAAGCATGAGTATCATCTTCTCGAGAAGATGATACTCATGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002615.3-448s1c2
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-1100s1c1
Sequence:CCGGCCCAAGCTGAAGCTGAGTTATCTCGAGATAACTCAGCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-964s1c1
Sequence:CCGGCGGAAGCATGAGTATCATCTTCTCGAGAAGATGATACTCATGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-577s1c1
Sequence:CCGGCCGGATCGTCTTTGAGAAGAACTCGAGTTCTTCTCAAAGACGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-448s1c1
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-1165s1c1
Sequence:CCGGCTTGTTTGATTCACCAGACTTCTCGAGAAGTCTGGTGAATCAAACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002615
VALIDATED
SERPINF1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-1100s21c1
Sequence:CCGGCCCAAGCTGAAGCTGAGTTATCTCGAGATAACTCAGCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-577s21c1
Sequence:CCGGCCGGATCGTCTTTGAGAAGAACTCGAGTTCTTCTCAAAGACGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-448s21c1
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002615.4-1041s21c1
Sequence:CCGGCCGAGTTCATTCATGACATAGCTCGAGCTATGTCATGAATGAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-964s21c1
Sequence:CCGGCGGAAGCATGAGTATCATCTTCTCGAGAAGATGATACTCATGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002615.3-448s1c2
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-1100s1c1
Sequence:CCGGCCCAAGCTGAAGCTGAGTTATCTCGAGATAACTCAGCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-964s1c1
Sequence:CCGGCGGAAGCATGAGTATCATCTTCTCGAGAAGATGATACTCATGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-577s1c1
Sequence:CCGGCCGGATCGTCTTTGAGAAGAACTCGAGTTCTTCTCAAAGACGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-448s1c1
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-1165s1c1
Sequence:CCGGCTTGTTTGATTCACCAGACTTCTCGAGAAGTCTGGTGAATCAAACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002615
VALIDATED
SERPINF1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-1100s21c1
Sequence:CCGGCCCAAGCTGAAGCTGAGTTATCTCGAGATAACTCAGCTTCAGCTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-577s21c1
Sequence:CCGGCCGGATCGTCTTTGAGAAGAACTCGAGTTCTTCTCAAAGACGATCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-448s21c1
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002615.4-1041s21c1
Sequence:CCGGCCGAGTTCATTCATGACATAGCTCGAGCTATGTCATGAATGAACTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002615.4-964s21c1
Sequence:CCGGCGGAAGCATGAGTATCATCTTCTCGAGAAGATGATACTCATGCTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002615.3-448s1c2
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-1100s1c1
Sequence:CCGGCCCAAGCTGAAGCTGAGTTATCTCGAGATAACTCAGCTTCAGCTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-964s1c1
Sequence:CCGGCGGAAGCATGAGTATCATCTTCTCGAGAAGATGATACTCATGCTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-577s1c1
Sequence:CCGGCCGGATCGTCTTTGAGAAGAACTCGAGTTCTTCTCAAAGACGATCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-448s1c1
Sequence:CCGGGCAGCGAACAGAATCCATCATCTCGAGATGATGGATTCTGTTCGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002615.3-1165s1c1
Sequence:CCGGCTTGTTTGATTCACCAGACTTCTCGAGAAGTCTGGTGAATCAAACAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???