EMAIL THIS PAGE TO A FRIEND

SERPING1

serpin peptidase inhibitor, clade G (C1 inhibitor), member 1

72 Gene Product Result for
Synonyms: C1IN C1INH C1NH HAE1 HAE2
Gene ID:
Human(710) Summary: This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its protein inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. Deficiency of this protein is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, Jul 2008]
Mouse(12258) serine (or cysteine) peptidase inhibitor, clade G, member 1
Rat(295703) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Zebrafish(567801) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
chicken(423132) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
dog(475966) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
domestic cat(101087683) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
naked mole-rat(101724898) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
domestic guinea pig(100735994) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
cow(281035) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0541 AQUA Peptide AASAISVA[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000062 Rosetta Predictions human pricing
NM_001032295 Rosetta Predictions human pricing
NM_199093 Rosetta Predictions rat pricing
NM_009776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220086 predicted 1236
2 SASI_Hs01_00220087 predicted 1022
3 SASI_Hs01_00220088 predicted 872
4 SASI_Hs01_00220089 predicted 1405
5 SASI_Hs01_00220092 predicted 1064
6 SASI_Hs01_00220093 predicted 864
7 SASI_Hs02_00301777 predicted 827
8 SASI_Hs01_00220094 predicted 939
9 SASI_Hs01_00220095 predicted 1702
10 SASI_Hs02_00301778 predicted 1428
11 SASI_Hs01_00220090 predicted 1280
12 SASI_Hs01_00220091 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236371 predicted 1082
2 SASI_Hs01_00236372 predicted 867
3 SASI_Hs01_00236373 predicted 727
4 SASI_Hs01_00236374 predicted 1255
5 SASI_Hs01_00236377 predicted 908
6 SASI_Hs01_00236378 predicted 716
7 SASI_Hs02_00307883 predicted 680
8 SASI_Hs01_00236379 predicted 791
9 SASI_Hs01_00236380 predicted 1548
10 SASI_Hs02_00307884 predicted 1275
11 SASI_Hs01_00236375 predicted 1126
12 SASI_Hs01_00236376 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057022 predicted 1244
2 SASI_Rn01_00057023 predicted 440
3 SASI_Rn01_00057024 predicted 1284
4 SASI_Rn01_00057025 predicted 500
5 SASI_Rn01_00057026 predicted 506
6 SASI_Rn02_00270103 predicted 1301
7 SASI_Rn01_00057027 predicted 750
8 SASI_Rn01_00057028 predicted 712
9 SASI_Rn01_00057029 predicted 1224
10 SASI_Rn01_00057030 predicted 1312
11 SASI_Rn01_00057031 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068744 predicted 284
2 SASI_Mm01_00068745 predicted 868
3 SASI_Mm01_00068746 predicted 1226
4 SASI_Mm01_00068747 predicted 430
5 SASI_Mm01_00068748 predicted 311
6 SASI_Mm01_00068749 predicted 1316
7 SASI_Mm01_00068750 predicted 1068
8 SASI_Mm01_00068752 predicted 1343
9 SASI_Mm01_00068753 predicted 794
10 SASI_Mm02_00317000 predicted 976
11 SASI_Mm01_00068751 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000062
SERPING1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-241s21c1
Sequence:CCGGGGGATAGAGCCTCCTCAAATCCTCGAGGATTTGAGGAGGCTCTATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-1080s21c1
Sequence:CCGGGCCAAGTGGAAGACAACATTTCTCGAGAAATGTTGTCTTCCACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-335s21c1
Sequence:CCGGAGTTATCTCCAAGATGCTATTCTCGAGAATAGCATCTTGGAGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-1234s1c1
Sequence:CCGGCAGCCCACTCTCCTAACACTACTCGAGTAGTGTTAGGAGAGTGGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-924s1c1
Sequence:CCGGCCTCCTCAATGCTATCTACCTCTCGAGAGGTAGATAGCATTGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000062.x-1748s1c1
Sequence:CCGGCCATGCTCTCCAAACCACTTTCTCGAGAAAGTGGTTTGGAGAGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-1117s1c1
Sequence:CCGGCTGAGTTTGGTGATCCTGGTACTCGAGTACCAGGATCACCAAACTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000062
SERPING1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-241s21c1
Sequence:CCGGGGGATAGAGCCTCCTCAAATCCTCGAGGATTTGAGGAGGCTCTATCCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000373450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-1080s21c1
Sequence:CCGGGCCAAGTGGAAGACAACATTTCTCGAGAAATGTTGTCTTCCACTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000373451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-335s21c1
Sequence:CCGGAGTTATCTCCAAGATGCTATTCTCGAGAATAGCATCTTGGAGATAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-1234s1c1
Sequence:CCGGCAGCCCACTCTCCTAACACTACTCGAGTAGTGTTAGGAGAGTGGGCTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-924s1c1
Sequence:CCGGCCTCCTCAATGCTATCTACCTCTCGAGAGGTAGATAGCATTGAGGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000062.x-1748s1c1
Sequence:CCGGCCATGCTCTCCAAACCACTTTCTCGAGAAAGTGGTTTGGAGAGCATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-1117s1c1
Sequence:CCGGCTGAGTTTGGTGATCCTGGTACTCGAGTACCAGGATCACCAAACTCAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000062
SERPING1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-241s21c1
Sequence:CCGGGGGATAGAGCCTCCTCAAATCCTCGAGGATTTGAGGAGGCTCTATCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-1080s21c1
Sequence:CCGGGCCAAGTGGAAGACAACATTTCTCGAGAAATGTTGTCTTCCACTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000062.2-335s21c1
Sequence:CCGGAGTTATCTCCAAGATGCTATTCTCGAGAATAGCATCTTGGAGATAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-1234s1c1
Sequence:CCGGCAGCCCACTCTCCTAACACTACTCGAGTAGTGTTAGGAGAGTGGGCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-924s1c1
Sequence:CCGGCCTCCTCAATGCTATCTACCTCTCGAGAGGTAGATAGCATTGAGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000062.x-1748s1c1
Sequence:CCGGCCATGCTCTCCAAACCACTTTCTCGAGAAAGTGGTTTGGAGAGCATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000062.x-1117s1c1
Sequence:CCGGCTGAGTTTGGTGATCCTGGTACTCGAGTACCAGGATCACCAAACTCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009776
SERPING1 MISSION shRNA Bacterial Glycerol Stock
serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1047s1c1
Sequence:CCGGCATGATGAGTAGCGTAAAGTACTCGAGTACTTTACGCTACTCATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009776.1-1590s1c1
Sequence:CCGGTGGGTAAACATTGTCACCCAACTCGAGTTGGGTGACAATGTTTACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1263s1c1
Sequence:CCGGCCTGACGATGCCTCATATAAACTCGAGTTTATATGAGGCATCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-568s1c1
Sequence:CCGGGCTAAGACCAACATGGCCTTTCTCGAGAAAGGCCATGTTGGTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1044s1c1
Sequence:CCGGGCCCATGATGAGTAGCGTAAACTCGAGTTTACGCTACTCATCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009776
SERPING1 MISSION shRNA shRNA Plasmid DNA
serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1047s1c1
Sequence:CCGGCATGATGAGTAGCGTAAAGTACTCGAGTACTTTACGCTACTCATCATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009776.1-1590s1c1
Sequence:CCGGTGGGTAAACATTGTCACCCAACTCGAGTTGGGTGACAATGTTTACCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1263s1c1
Sequence:CCGGCCTGACGATGCCTCATATAAACTCGAGTTTATATGAGGCATCGTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-568s1c1
Sequence:CCGGGCTAAGACCAACATGGCCTTTCTCGAGAAAGGCCATGTTGGTCTTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1044s1c1
Sequence:CCGGGCCCATGATGAGTAGCGTAAACTCGAGTTTACGCTACTCATCATGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009776
SERPING1 MISSION shRNA Lentiviral Transduction Particles
serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1047s1c1
Sequence:CCGGCATGATGAGTAGCGTAAAGTACTCGAGTACTTTACGCTACTCATCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009776.1-1590s1c1
Sequence:CCGGTGGGTAAACATTGTCACCCAACTCGAGTTGGGTGACAATGTTTACCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1263s1c1
Sequence:CCGGCCTGACGATGCCTCATATAAACTCGAGTTTATATGAGGCATCGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-568s1c1
Sequence:CCGGGCTAAGACCAACATGGCCTTTCTCGAGAAAGGCCATGTTGGTCTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009776.1-1044s1c1
Sequence:CCGGGCCCATGATGAGTAGCGTAAACTCGAGTTTACGCTACTCATCATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)