EMAIL THIS PAGE TO A FRIEND

SET

SET nuclear oncogene

96 Gene Product Result for
Synonyms: 2PP2A I2PP2A IGAAD IPP2A2 PHAPII TAF-I TAF-IBETA
Gene ID:
Human(6418) Summary: The protein encoded by this gene inhibits acetylation of nucleosomes, especially histone H4, by histone acetylases (HAT). This inhibition is most likely accomplished by masking histone lysines from being acetylated, and the consequence is to silence HAT-dependent transcription. The encoded protein is part of a complex localized to the endoplasmic reticulum but is found in the nucleus and inhibits apoptosis following attack by cytotoxic T lymphocytes. This protein can also enhance DNA replication of the adenovirus genome. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(56086) SET nuclear oncogene
Rat(307947) SET nuclear oncogene
fruit fly(41844) CG4299 gene product from transcript CG4299-RA
domestic cat(101081583) SET nuclear oncogene
dog(608952) SET nuclear oncogene
chicken(417210) SET nuclear oncogene
cow(538444) SET nuclear oncogene
sheep(101118680) SET nuclear oncogene
naked mole-rat(101720656) SET nuclear oncogene
domestic guinea pig(100715138) SET nuclear oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU158271 MISSION® esiRNA esiRNA targeting mouse Set mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122821 Rosetta Predictions human pricing
NM_003011 Rosetta Predictions human pricing
NM_001012504 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327365 predicted 588
2 SASI_Hs02_00327366 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334905 predicted 655
2 SASI_Hs02_00334906 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106954 predicted 674
2 SASI_Rn01_00106955 predicted 595
3 SASI_Rn01_00106956 predicted 607
4 SASI_Rn01_00106957 predicted 671
5 SASI_Rn01_00106959 predicted 654
6 SASI_Rn01_00106958 predicted 574
7 SASI_Rn01_00106960 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003011
VALIDATED
SET MISSION shRNA Bacterial Glycerol Stock
SET nuclear oncogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003011.1-94s1c1
Sequence:CCGGGCGATTGAACACATTGATGAACTCGAGTTCATCAATGTGTTCAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003011.1-700s1c1
Sequence:CCGGGAAGAAGATGATGATGATGATCTCGAGATCATCATCATCATCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003011.1-326s1c1
Sequence:CCGGCCAGAGTTGAAGTGACAGAATCTCGAGATTCTGTCACTTCAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003011.1-467s1c1
Sequence:CCGGCCACCGAAATCAAATGGAAATCTCGAGATTTCCATTTGATTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003011.1-2334s1c1
Sequence:CCGGGCTGAAATTAAATGCCACTTTCTCGAGAAAGTGGCATTTAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-676s21c1
Sequence:CCGGCCAGAGTTGAAGTGACAGAATCTCGAGATTCTGTCACTTCAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-1050s21c1
Sequence:CCGGGAAGAAGATGATGATGATGATCTCGAGATCATCATCATCATCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-444s21c1
Sequence:CCGGGCGATTGAACACATTGATGAACTCGAGTTCATCAATGTGTTCAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-817s21c1
Sequence:CCGGCCACCGAAATCAAATGGAAATCTCGAGATTTCCATTTGATTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003011
VALIDATED
SET MISSION shRNA shRNA Plasmid DNA
SET nuclear oncogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003011.1-94s1c1
Sequence:CCGGGCGATTGAACACATTGATGAACTCGAGTTCATCAATGTGTTCAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003011.1-700s1c1
Sequence:CCGGGAAGAAGATGATGATGATGATCTCGAGATCATCATCATCATCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003011.1-326s1c1
Sequence:CCGGCCAGAGTTGAAGTGACAGAATCTCGAGATTCTGTCACTTCAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003011.1-467s1c1
Sequence:CCGGCCACCGAAATCAAATGGAAATCTCGAGATTTCCATTTGATTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003011.1-2334s1c1
Sequence:CCGGGCTGAAATTAAATGCCACTTTCTCGAGAAAGTGGCATTTAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-676s21c1
Sequence:CCGGCCAGAGTTGAAGTGACAGAATCTCGAGATTCTGTCACTTCAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-1050s21c1
Sequence:CCGGGAAGAAGATGATGATGATGATCTCGAGATCATCATCATCATCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-444s21c1
Sequence:CCGGGCGATTGAACACATTGATGAACTCGAGTTCATCAATGTGTTCAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-817s21c1
Sequence:CCGGCCACCGAAATCAAATGGAAATCTCGAGATTTCCATTTGATTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003011
VALIDATED
SET MISSION shRNA Lentiviral Transduction Particles
SET nuclear oncogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003011.1-94s1c1
Sequence:CCGGGCGATTGAACACATTGATGAACTCGAGTTCATCAATGTGTTCAATCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003011.1-700s1c1
Sequence:CCGGGAAGAAGATGATGATGATGATCTCGAGATCATCATCATCATCTTCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003011.1-326s1c1
Sequence:CCGGCCAGAGTTGAAGTGACAGAATCTCGAGATTCTGTCACTTCAACTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003011.1-467s1c1
Sequence:CCGGCCACCGAAATCAAATGGAAATCTCGAGATTTCCATTTGATTTCGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003011.1-2334s1c1
Sequence:CCGGGCTGAAATTAAATGCCACTTTCTCGAGAAAGTGGCATTTAATTTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-676s21c1
Sequence:CCGGCCAGAGTTGAAGTGACAGAATCTCGAGATTCTGTCACTTCAACTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-1050s21c1
Sequence:CCGGGAAGAAGATGATGATGATGATCTCGAGATCATCATCATCATCTTCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-444s21c1
Sequence:CCGGGCGATTGAACACATTGATGAACTCGAGTTCATCAATGTGTTCAATCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003011.3-817s21c1
Sequence:CCGGCCACCGAAATCAAATGGAAATCTCGAGATTTCCATTTGATTTCGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023871
VALIDATED
SET MISSION shRNA Bacterial Glycerol Stock
SET nuclear oncogene
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023871.3-758s21c1
Sequence:CCGGACGCAGGTGCTGATGAGTTAGCTCGAGCTAACTCATCAGCACCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023871.2-617s1c1
Sequence:CCGGCGTCTTCAAAGTCCACCGAAACTCGAGTTTCGGTGGACTTTGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-1428s1c1
Sequence:CCGGCCAACATGTATCTGTCTACTTCTCGAGAAGTAGACAGATACATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-832s1c1
Sequence:CCGGCCCGACATGGATGATGAAGAACTCGAGTTCTTCATCATCCATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-249s1c1
Sequence:CCGGGCAAGAAGCAATTGAACATATCTCGAGATATGTTCAATTGCTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-724s1c1
Sequence:CCGGGAGAGCTTCTTTACCTGGTTTCTCGAGAAACCAGGTAAAGAAGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023871.3-1195s21c1
Sequence:CCGGATCTCCGTTTCTGTTCTTAATCTCGAGATTAAGAACAGAAACGGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023871.3-1134s21c1
Sequence:CCGGACATCATGGTTCTCAATTAATCTCGAGATTAATTGAGAACCATGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023871.3-522s21c1
Sequence:CCGGATCAGGTTACAGAATAGATTTCTCGAGAAATCTATTCTGTAACCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023871
VALIDATED
SET MISSION shRNA shRNA Plasmid DNA
SET nuclear oncogene
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023871.3-758s21c1
Sequence:CCGGACGCAGGTGCTGATGAGTTAGCTCGAGCTAACTCATCAGCACCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023871.2-617s1c1
Sequence:CCGGCGTCTTCAAAGTCCACCGAAACTCGAGTTTCGGTGGACTTTGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-1428s1c1
Sequence:CCGGCCAACATGTATCTGTCTACTTCTCGAGAAGTAGACAGATACATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-832s1c1
Sequence:CCGGCCCGACATGGATGATGAAGAACTCGAGTTCTTCATCATCCATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-249s1c1
Sequence:CCGGGCAAGAAGCAATTGAACATATCTCGAGATATGTTCAATTGCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-724s1c1
Sequence:CCGGGAGAGCTTCTTTACCTGGTTTCTCGAGAAACCAGGTAAAGAAGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023871.3-1195s21c1
Sequence:CCGGATCTCCGTTTCTGTTCTTAATCTCGAGATTAAGAACAGAAACGGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023871.3-1134s21c1
Sequence:CCGGACATCATGGTTCTCAATTAATCTCGAGATTAATTGAGAACCATGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023871.3-522s21c1
Sequence:CCGGATCAGGTTACAGAATAGATTTCTCGAGAAATCTATTCTGTAACCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023871
VALIDATED
SET MISSION shRNA Lentiviral Transduction Particles
SET nuclear oncogene
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023871.3-758s21c1
Sequence:CCGGACGCAGGTGCTGATGAGTTAGCTCGAGCTAACTCATCAGCACCTGCGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023871.2-617s1c1
Sequence:CCGGCGTCTTCAAAGTCCACCGAAACTCGAGTTTCGGTGGACTTTGAAGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-1428s1c1
Sequence:CCGGCCAACATGTATCTGTCTACTTCTCGAGAAGTAGACAGATACATGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-832s1c1
Sequence:CCGGCCCGACATGGATGATGAAGAACTCGAGTTCTTCATCATCCATGTCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-249s1c1
Sequence:CCGGGCAAGAAGCAATTGAACATATCTCGAGATATGTTCAATTGCTTCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023871.2-724s1c1
Sequence:CCGGGAGAGCTTCTTTACCTGGTTTCTCGAGAAACCAGGTAAAGAAGCTCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023871.3-1195s21c1
Sequence:CCGGATCTCCGTTTCTGTTCTTAATCTCGAGATTAAGAACAGAAACGGAGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023871.3-1134s21c1
Sequence:CCGGACATCATGGTTCTCAATTAATCTCGAGATTAATTGAGAACCATGATGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023871.3-522s21c1
Sequence:CCGGATCAGGTTACAGAATAGATTTCTCGAGAAATCTATTCTGTAACCTGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???